18
Select the correct answers
Which two elements of writing are best suited to an experienced audience?
Simple, short sentences
technical terms
common speech
jargon
familiar phrasing
Reset
Next

Answers

Answer 1

Answer:

I think is common speech


Related Questions

What type of rhetorical device
does the author use in the
underlined portion of this
argument?
s
A. It gives a call to action in support of
the author's ideas and claims.
B. It uses a rhetorical question (question
asked by the author to which no answer is
expected)
C. It uses a logical appeal, giving data and
support for the author's claims.

Answers

I believe it’s C it’s gives the right impression

Realism + Naturalism
What is time of this period?
What happened?
Who was in that period?
If you and answer my question, i'll give you 5 stars and a heart.
if you answer not correct and for score i'll report you.
( You can search it, just because i'm lazy to read it. )

Answers

What is the time of this period?

Between 1870 and 1910, there were two main movements that took place in American literature: realism and naturalism.

What happened?

Realism attempted to depict things as they actually are, which contrasted with the previously dominant aesthetic of romanticism. Naturalism attempted to depict things realistically, but focused on determinism, or the inability of people to resist their circumstances.

Who was in that period?

Realism as a broad movement in art and literature survived until the end of the nineteenth century, but it changed in the 1870s, when the artist Jules Bastien-Lepage (1848–1884) introduced a form of painting that today is generally referred to as naturalism.

Thank You, I hope I could make your day just a little bit better!

Have a great day!

My opponent Janet Jones is a candidate for president of Chess Club. But what qualifies her for this role? Janet has admitted that she called other students insulting names on the playground in fifth grade. Those were verbal assaults. Then she did not answer when the playground monitor tried to find out who was yelling. That's lying, plain and simple. Do you want to elect someone who commits assault and lies? That would be an insult to members of the Chess Club.

Answers

This logic is somewhat flawed. This is an event that happened in the past, in 5th grade. Everyone sucks in the 5th grade. People can change, and using a singular event to deter someone from voting for a potentially solid candidate based on an outdated action.

the merchant of venice what was the consequence of the wrong casket

Answers

Answer:

There is an additional penalty for those suitors who choose the wrong casket. They must, as Portia says, swear an oath to remain a bachelor for the rest of their days: Or swear, before you choose,—if you choose wrong, Never to speak to lady afterward In way of marriage

He _____ to music at the moment. * 1 คะแนน

listening
listens
listen
is listening​

Answers

Answer:

listens

Explanation:

100 word essay on greek mythology

Answers

Answer:

Logo

X ESSAY EXAMPLES WRITING TIPS

WRITING GUIDESWORDS PER PAGE PLAGIARISM CHECKER HIRE WRITERLOG IN

We use cookies to give you the best experience possible. By continuing we’ll assume you’re on board with our cookie policy

Home Page Literature Mythology Greek Mythology Essay

Greek Mythology Essay

Download:

.pdf, .docx, .epub, .txt

University/College:

University of Chicago

Type of essay:

Essay

A LIMITED TIME OFFER!

Get custom essay sample written according to your requirements

URGENT 3H DELIVERY GUARANTEED

ORDER NOW

No matter what you think the ancient Greeks were not on drugs. The people of ancient Greece had an extremely intelligent society. They had sophisticated architecture and a very high level of mathematics in their culture. These areas of life dealt with real things that could be controlled. When it came to natural phenomena the Greeks had certain explanations that might look eccentric now, but were reasonable 3000 years ago. In Greeces history there are several themes that contributed to Greek mythology and reasons it developed.

Once Greek mythology was established in the culture an interesting set of gods and beliefs evolved and continued to evolve for hundreds of years. Two of these gods that you are most likely to be familiar with are Zeus and Apollo. If you understand how and why Greek mythology came about, the idea of Greek mythology wont seem so weird. The location of Greece itself lends itself to many different cultures. It is centrally located between Europe, Asia and Africa. With all three having extremely distinct and varied cultures. Travelers would share their ideas and thoughts with the locals as they went through Greece.

Explanation:

please mark my answer in brainlist plz

Which lines from “I, Too” best develop an uplifting tone?
A. I too sing America /I am the darker brother.
B. But I laugh /and eat well /and grow strong.
C. And be ashamed- I, too, am America.
D. Nobody’ll dare/ Say to me.

Answers

The answer is actually (B) I believe,

- to laugh eat well & grow strong are all uplifting representations.

The lines from “I, Too” best develop an uplifting tone B. But I laugh /and eat well /and grow strong.

What are the use of uplifting representation?

The English Textual Concepts surely define the idea of representation. The depiction of a thing, man or woman or concept in written, visual, executed or spoken language.

In representing we make selections from the language provided with the aid of using those modes.But I laugh and eat well and grow strong ar all the uplifting tone as thy shows about the uplifting tone.

Read more about the uplifting tone:

https://brainly.com/question/25627023

#SPJ2

The author frequently revisits her memories of certain people and places.

Answers

Answer:

Start studying from Rituals of Memory Analyze the Text. ... it is like the looped relationships with places, our communities, and even our own families.

Explanation:

What is the name of the rabbit in frosty the snowman?

Answers

Answer:

Hocus Pocus.

Hope this helps❤

The answer to this question is Hocus Pocus

PLEASE HELP I"LL GIVE BRainLEST

To _____ is to find values by substituting numbers for variables.

evaluate

try

express

group

Answers

Answer:

Evaluate

Explanation:

Answer:

Evaluate

Explanation:

You have to solve the equation to find out what number each variable is.

Read the excerpt from "Poetry. " I, too, dislike it: there are things that are important beyond all this fiddle. Reading it, however, with a perfect contempt for it, one discovers in it after all, a place for the genuine. Based on context, what is the most likely definition for "fiddle"? length noise violin nonsense.

Answers

Answer:

nonsense.

Explanation:

Based on context, is nonsense the most likely definition for "fiddle" Therefore option D is correct.

What is a violin?

The violin, commonly known as a fiddle, is a wooden chordophone (string instrument) in the violin family. The body of most violins is made of hollow wood. The violin typically has four strings (although some can have five), is usually tuned in perfect fifths with the notes G3, D4, A4, and E5, and is most frequently played by drawing a bow across its strings.

As a result, it is the smallest and highest-pitched instrument (soprano) in the family that is used regularly. Additionally, it may be played by pinching the strings with the fingers (pizzicato), and in some circumstances, the wooden side of the bow can be used to strike the strings (col legno).

The violin is a crucial instrument in many different types of music. They are most prevalent in the Western classical heritage, both as solo instruments and in groups ranging from chamber music to symphonies. In addition, violins play a significant role in a number of folk music genres, such as jazz, country, and bluegrass.

Some styles of rock music and jazz fusion employ electric violins with solid bodies and piezoelectric pickups, with the pickups connected to instrument amplifiers and speakers to generate sound.

To learn more about violin follow the link.

https://brainly.com/question/19158319


#SPJ2

Jules has significant pain and bleeding when he brushes his teeth. What should he tell his dentist at his upcoming appointment?

“My teeth hurt sometimes.”
“My toothbrush is too hard.”
“My teeth feel fine most of the time.”
“When I brush, I feel pain and my gums bleed.”

Answers

Answer:

When I brush, I feel pain and my gums bleed

Explanation:

Its describing what he is going through

Answer:

When I brush, I feel pain and my gums bleed.

Explanation:

The more information you give your dentist the better it is for them to give you a more arcuate answer for what they might what you to do. So if you were to tell them all the details they can be looking for certain things to see if there is something wrong.

when you think carefully and closely about your essay topic, you are engaging in the very important process of _____.

Answers

Answer:

Drafting.

Explanation:

Will I get help to level up???

Answers

Answer:

Yes bc your a cool person.... Gimme brainliest now <3

Explanation:

What is a theme of “Old Ironsides”?

The passage of time does not diminish the value of past accomplishments.

The glories of war are outweighed by the tragic loss of human life.

There is peace that comes with acceptance of life’s struggles.

Nations must consider the possibility of danger when taking risks.

Answers

A theme in “Old Ironsides” is that the passage of time does not diminish the value of past achievements, as shown in the first answer option.

We can arrive at this answer because:

The poem features a very old warship.This ship won many battles, suffered many hardships, but it had great meaning for the people.After all, the ship survived, and that represented the nation's resilience, strength, and bravery.

With that, we can say that the poem affirms that the ship is very important because of the previous accomplishments that it conquered. These achievements cannot be erased over time.

More information about "Old Ironsides" at the link:

https://brainly.com/question/1022857

Answer:

The passage of time does not diminish the value of past accomplishments.

Explanation:

took test

Who wrote the Declaration of Independence? Thomas Jefferson John Hancock Alexander Hamilton George Washington.

Answers

Thomas Jefforson along with Ben Franklin, John Adams, Roger Sherman, and Robert Livingston

Answer:

Its A, Thomas Jefferson.

Explanation:

Edge 2022. Hope this helps! Good luck <3

What is ashamvav not allowed to do ​

Answers

[tex] \color{magenta} \huge{ANSWER}{} [/tex]

ashamvav was not allowed to enter hermital at night

[tex] \green{hope \: \: it \: \: helps}[/tex]

_________ communication is confident, self-assured, positive communication.
a. Interpersonal
b. Assertive
c. Management
d. Aggressively

Answers

Answer:

Managment (C)

Explanation:

It's management, Because you have to manage your communication, and it's not D because you're not suppose to be aggressive.

Answer:

C

Explanation:

identify clause : I do it because I choose to​

Answers

Answer:

because I choose to { dependent clause }

I do it { independent clause }

A rubric explains how your teacher will determine how many points each test is worth over the course of a semester. Please select the best answer from the choices provided T F.

Answers

Answer: False

Explanation: A rubric is for determining how many points a student will recieve on any given assignment. It's not just for tests. Actually rubrics aren't used for tests at all, only other normal assignment. Hope this helps, God bless!

Answer:

false

Explanation:

just took the test

5. "He said to Me" What should do you eat?​

Answers

whatever is in the fridge
Eat something good, something hot and big to feel you up I guess :)

An epic revolves around the
of the epic hero.
A)romantic love interest
B) heritage
C)journey
D)childhood
E)companionship

Answers

Answer:

journey

is the answer

Explanation:

I think epic is go around with the epic hero.

His/her journey take them to their platform

What is an inference supported by the text about characteristics in two different biomes?

Answers

An inference is a conclusion that is reached based on certain pieces of evidence.

The text from which we are to answer this question was not included.

However, to help you arrive at the right answer, read the text carefully to deduce the stated facts about the characteristics of the two biomes.

Based on your reading of the text, form a conclusion based on your understanding of the evidence in the text.

Learn more about inference here:

https://brainly.com/question/1081576

Do you agree or disagree that the greeting of "Merry Christmas" could offend those who observe other holidays?​

Answers

agree.

Explanation:

usually it's best to ask someone what their beliefs are. while a lot of people dont get offended, some do. in situations where you're in public being nice to someone, and you say merry Christmas, theres usually no time to start a conversation and ask what their beliefs are but in situations where you know the person, or are trying to get to know them, or even having a conversation with them, its best to ask before you say the phrase to someone that observes another holiday. a lot of people try to push their beliefs on others and others are very passionate about what they believe and/or celebrate so its easy to see "merry christmas" the wrong way when you don't celebrate it.

What is the most effective way to use textual evidence in a comparative essay?

Include only textual evidence from the source presented first, at the beginning of the essay.

Include only one piece of textual evidence from each of the sources you compare or contrast.

Include only textual evidence that readers may have missed when they read or saw the source.

Include an equal amount of textual evidence from each source evenly throughout the essay.

Answers

Answer:

include an equal amount of textual evidence from each source evenly throughout the essay

Include an equal amount of textual evidence from each source evenly throughout the essay is the most effective way to use textual evidence in a comparative essay. Hence, option D is correct.

What is textual evidence?

Textual evidence is accepted text that has been verified and taken from the original source or document to support a thesis or an argument. It typically takes the shape of a quotation or descriptive text.

There are three main sorts of evidence that must be provided in order to persuade the reader that the writer's arguments are accurate. These three categories are judgment, fact, and witness. This page examines the various types of evidence used in reasoning. View the page on logic and arguments as well.

Evidence that supports a claim or thesis and is derived from the source text or other texts is known as textual evidence. This kind of evidence can take the form of a quotation, a paraphrased passage, or a book synopsis.

Thus, option D is correct.

For more information about textual evidence, click here:

https://brainly.com/question/9355555

#SPJ2

The author uses the word "dash" to
emphasize that Persephone is trying
to get somewhere in a
He uses the words
"fumbled" and "struggled" to show
that Persephone is experiencing
along the way. The
author's choice of words creates a
tone.

Answers

Answer:

The tone that results from these words being used is frantic and/or suspenseful, creating a sense of action and conflict within the text.

Hi Brainlers, I've been attempting creating a story but as a teen I am, I'm to busy. I've come up with a title but I'm trying to think of alternatives. It's like a series where the main character, a girl along with her girl squad unravel mysteries concerning family, teen issues and school life. Could someone helpe with a title, please?

Answers

Answer:

Ohh i love doing these things!!!!!!

Explanation:

Here are some examples of a title. Maybe they will help:

"Lure the Truth", since it has to do with family mysteries?

"The Remains of Yesterday", since it is based on the main character's life?

"Strike the Lie", since life is, well, a lie in general?

Maybe these could help. From one teenager to another, I wish you good luck!!!

Pick more than one if needed plz

Question 3 (2 points) ✓ Saved According to the information in Lesson 6.01 Bram Stoker, how was the novel Dracula first received by Victorian readers?

A.Some Victorian readers found the Dracula novel to be disturbing with contrived events that were too horrific.

B.Some Victorian readers found the Dracula novel to be an outstanding thriller.

C.Victorian era society banned the novel Dracula after the first publication because it dealt with the supernatural.

D.Dracula received mixed reviews by its Victorian readers.​

Answers

Answer:

The answer is A I think»»» ✓

george swam in the aquarium and the sharks where scared

Answers

Answer: what you know about rollin down in the deep

Explanation:

What is the most likely outcome of a collaborative discussion about point of view in a work of fiction?
a better understanding of how choice of narrator can shape a story’s overall effect
a better understanding of how an author’s own childhood experiences affect a story
a better understanding the correct way to interpret a story that your discussion group read
a better understanding of the author’s reasons for writing fiction instead of poetry

Answers

Answer:

Chose this:

A better understanding of how choice of narrator can shape a story’s overall effect

Explanation:

Answer:

a better understanding of how choice of narrator can shape a story’s overall effect

Explanation:

Discussing a story’s point of view with other readers forces you to think about the choices authors must make about narrators and how those choices affect other aspects of the story.

Also, I took the quiz :)

Other Questions
5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet 3. Solve the formula A = 1/2 (b1+ b2))h for h. Show your work.