Answer:
In Jacksons talk about his depressing story he talks about how after a natural disaster such as a hurricane there is some kind of successional sequence of recovery but now what's happening is that overfishing, pollution, and climate change are all interacting In a way that prevents the recovery.
Explanation:
I had the same question in my marine science class and got it right.
This part of a plant cell makes the process of photosynthesis possible.
Chloroplast
O Mitochondria
O Centrioles
The chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.
Photosynthesis refers to the metabolic reactions by which plant cells synthesize simple carbohydrates (glucose) by using the light energy from the sun and carbon dioxide.Photosynthetic reactions can be divided into light-dependent reactions and light-independent reactions.During photosynthesis, light-dependent reactions occur in the thylakoid membranes of chloroplasts.In conclusion, the chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.
Learn more about chloroplasts here:
https://brainly.com/question/2512051
My dad scolded me i don’t wanna live with him I hate him
The desertification of an area from deforestation due to mining gold would be a(n) ___ cost of the gold.
indirect
direct
Answer: the answer would be indirect
[answers included, 100% on assignment]
1. Compared to today’s corn plant, teosinte:
✔ (c) is shorter and has more branches.
2. About how many genes were involved in producing the dramatic differences between teosinte and modern corn?
✔ (b) 5
3. he gene for which of the following traits changed early in teosinte domestication and caused dramatic changes?
✔ (a) kernel covering
Answer:
C
B
A
Explanation:
Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.
Here is fs fs da last graph I need help so someone plz help me
Your skeleton enables you to move.
True
False
Answer:
True
Explanation:
Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Answer:
Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.
Explanation:
please mark my answer in brainlist
In which of the following ways can albert reduce the resources he consumes
Answer:
where is option man?
please,send option also
According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?
Answer: Isaac
Explanation:
I hate my biology teacher but he’s such a D.a.d.d.y
Answer: Dam
Explanation: Dammmmmmmmm
How can i earn money from this app?
Answer:
u dont earn money from brainly. the point is altruistic help
Explanation:
if u mean something else, provide context and ill leave a comment with the correct answer
Proteins are synthesized based on genetic information carried by DNA. Explain In you’re own words how the structure of DNA is important in the
synthasis of different kinds of proteins, In your explanation, include a description of the two main processes involved in
protein synthesis.
Answer:
Explanation:The synthesis of proteins occurs in two sequential steps: Transcription and Translation. Transcription occurs in the cell nucleus and uses the base sequence of DNA to produce mRNA. The mRNA carries the message for making a specific protein out to the cytoplasm where translation occurs.
A white woman says she is not racist but avoids sitting near Black individuals. She has
A.high explicit racism, low implicit racism
B.high explicit racism, high implicit racism
C.low explicit racism, low implicit racism
D.low explicit racism, high implicit racis
How does the carbon stored in the bodies of living organisms move into rocks?(1 point)
Carbon dioxide released through respiration dissolves in certain rocks, like limestone.
Living organisms decay, releasing carbon into the soil, and soil is compacted into rocks.
Living organisms decay and become fossils fuels, which eventually become rocks.
Carbon dioxide dissolves in ocean water and is slowly absorbed by rocks in the ocean.
In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.
When animals die, their bodies degrade into the soil, encasing the carbon in layers that eventually transform into rock or minerals. hence option b is correct.
What is rock?Stone including limestone and its minerals is created when sediment and shell layers are bonded together over time.
Gases like carbon dioxide are among the forms of carbon that are stored in the atmosphere. Animals that consume the plants can then absorb and store this carbon.
When animals die, their bodies degrade into silt, encasing the carbon in layers that eventually transform into rock or minerals. Some of this silt may eventually turn into fossil fuels like coal, oil, or natural gas, which when burned, release carbon back into the atmosphere.
Therefore, when an animal dies to decompose into the soil which becomes rocks through carbon from living organisms moves into rocks, hence option b is correct.
Learn more about rocks, here:
https://brainly.com/question/23464190
#SPJ2
Deana applies the data in the table to calculate the rate of population increase or decrease of each country. Which assumption is necessary for Deana’s calculations to be accurate?
It should be noted that population is simply used for the determination of the economic activity of an area or country.
Your information is incomplete. Therefore, an overview of population will be given. Population simply means the inhabitants of a particular place or the number of organisms living in an area.
The increase or decrease in the rate of population is calculated by the formula:
= (New population - Old population) / Old population × 100
Learn more about population on:
https://brainly.com/question/13403673
Ba
Regarding cell walls, which of
these is the MOST accurate?
im
A. Cell walls and cell membranes are the very
same thing
B. Cell walls burst any time the cell takes in too
much water.
C. Cell walls keep a plant, bacteria or fungus cell
from bursting when too much water is absorbed
Answer:
C
Explanation:
cell wall
When water moves into a plant cell, the vacuole gets bigger, pushing the cell membrane against the cell wall. The force of this increases the turgor pressure within the cell making it firm or turgid . The pressure created by the cell wall stops too much water entering and prevents cell lysis.
In the pregnancy time the embryonic cells are developed into different types of cells,tissues,organs How??
Answer:
The embryonic stage plays an important role in the development of the brain. Approximately four weeks after conception, the neural tube forms. This tube will later develop into the central nervous system including the spinal cord and brain. The neural tube begins to form along with an area known as the neural plate.
Explanation:
PLEASE HELP WITH THIS ONE QUESTION
Answer:
Fourth option
Explanation:
ATP - Adenosine Triphosphate (3Ps), ADP - Adenosine Diphosphate (2Ps). ATP breaks down into ADP because it loses a Phosphate Anion in whatever process that the ATP is becoming ADP.
In the image provided, fourth image shows how ATP breaks down into ADP. Option D is the correct answer.
ATP (adenosine triphosphate) is a molecule that stores and provides energy for cellular processes. When ATP is used, it undergoes a process called hydrolysis, where a water molecule is used to break a high-energy phosphate bond in ATP. Option D is the correct answer.
During this hydrolysis process, one of the phosphate groups in ATP is cleaved off, resulting in the formation of ADP (adenosine diphosphate) and an inorganic phosphate (Pi). The energy stored in the phosphate bond is released, making it available for cellular functions. The breakdown of ATP into ADP allows the released energy to be utilized by cells for various activities, such as muscle contraction, active transport, and synthesis of molecules.
Learn more about Adenosine Triphosphate here:
https://brainly.com/question/897553
#SPJ2
28 The statements describe four different plants.
Which plant must be a monocotyledon?
A The flowers are wind-pollinated.
B The flowers each have five petals.
The leaves are large with a clear network of veins on them.
The leaves have parallel veins.
Answer:
The leaves have parallel veins
What is the function of the structure labeled C in the diagram to the right? it is where water, dissolved substances, and urea are filtered out of the blood.
Answer:
B. It captures the substances filtered out of the blood.
Explanation:
Edge 2021
Answer: B
It captures the substances filtered out of the blood.
Explanation:edge 2022
Which scenario describes an interaction between two of Earth’s spheres?
Water flows from a stream to a lake.
Gravity moves rocks to another location.
Lions use energy to catch other animals for food.
Bears dig big holes in the ground to protect their young.
Answer:
The scenario that describes an interaction between two of Earth's spheres is "bears dig big holes in the ground to protect their young".
Explanation:
The Earth spheres include the biosphere, the hydrosphere, the geosphere, and the atmosphere. In this context, there is an interaction between two spheres: the biosphere and the geosphere, when a bear digs holes in the ground because a living organism that is part of the biosphere is modifying the structure and shape of superficial soil, which is part of the geosphere.
ASAP
Give an example of psuedo-science and explain why it is not considered true science.
Answer:
Astrology
Explanation:
Astrology is considered a psuedo-science because there are not rock hard scientific facts. While it may have a lot of other evidence behind it, it is not a 'scientific' science.
Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin
Please explain if possible!
Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.
The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.
Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.
If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.
Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."
Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :a combining term that means "twisted" and is used to make composite words: streptococcus
Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.
Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).
The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.
Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.
Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.Sources: ( https://www.cdc.gov/ )
Abagnale's life could best be paraphrased as...
Answer:
running from the law and later working for the law.
Explanation:
Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.
Pandas eat bamboo for energy. What are pandas classified as
Answer:
A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.
Explanation:
A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.
Answer: consumers
Explanation: I took the test on edg
Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
Answer:
CCGATAGGT
Explanation:
got this for my hw.
Answer:
So the central dogma of molecular biology describes the journey from DNA to protein product:
DNA --transcription--> mRNA --translation--> Protein
Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).
In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.
5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’
We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:
mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.
Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.
To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.
5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'
Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu
Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.
In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.
Explanation:
n
Match the materials below to the BEST option describing their place in the cycles of photosynthesis and cellular respiration.
Some options may be used more than once or not at all.
pls check help /edtrphzjbi
Answer:
I don't get it but heres your answer
Explanation:
sharghvquvbOIQUugua
There you go!
Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?
A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano
Ik the answer is not c
Can someone help me figure this out plz and thank you
Answer: D
Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.
Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.
What is rock cycle ?
Rocks are naturally occurred on non-living earth which are made by collection of mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.
The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.
In a rock cycle, when the break down of these igneous rocks occur small particles that are transported and deposited to form sedimentary rocks, When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.
The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks
For more details regarding rock, visit
brainly.com/question/9243222
#SPJ2
Need help right now can’t figure it out
Answer:
[tex]\huge\boxed{Alkane.}[/tex]
Explanation:
The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.
[tex]\rule[225]{225}{2}[/tex]
Hope this helped!
~AH1807