6
Which issue first led to war between Rome and Carhage?
A the ability to get whear from Egypt
B the right to start colonies in Spain
the use of chariots in warfare
control of trade in the Mediterranean


Plssss I give the brainliest

Answers

Answer 1

Answer:

The immediate cause of the war was the issue of control of the independent Sicilian city state of Messana (modern Messina). In 264 BC Carthage and Rome went to war, starting the First Punic War.

Explanation:


Related Questions

jerry is a middle school student who has been identified as gifted. he excels in science and is particularly interested in paleontology. his scores in science, on the state level accountability test, exceeds that of any student in the state. jerry is taught in a general education classroom. how much time does jerry most likely receive from gifted services?

Answers

Jerry has been designated as bright and excels in science, therefore he is likely to receive some level of enrichment or acceleration to suit his advanced academic needs.

How much time does Jerry Gain?

Talented students in many school districts receive extra help through initiatives such as gifted and talented education (GATE) or special programs. These programs often include specialized training and activities that are suited to the students' skills and interests.

Jerry's time in gifted classes can range from a few hours per week to a few days per week, depending on the accessibility of resources and the specific programming options offered by his school or district. Some schools may provide gifted students separate spaces or specialized instruction, while others may offer focused enrichment activities within the general education classroom.

Learn more about gifted and talented education here: https://brainly.com/question/30653159

#SPJ4

Write at least 2 sentence using the following words: Trust,Process,Successful,Safety,and Pleasant.

Answers

I trust the safety process that my school provides. It makes me and other students feel more pleasant within the environment. Using this process makes everyone successful.

Answer:

I trust the process to help me get through hard time. The successful safety rules kept me safe and pleasant.

Which statement best paraphrases this text second, i'll make it easier and faster for high-skilled immigrants, graduates, and entrepreneurs to stay and contribute to our economy, as so many business leaders have proposed

Answers

Answer: D) Immigrants who can...

Explanation: Makes the most sense and did on E D

The statement that best paraphrases this text second is Immigrants who can contribute to the nation will be given greater chances to stay.

Who are immigrants?

Immigrants are people who move from one country or region to another with the intention of living there permanently or for an extended period of time. The immigrants are people who go from country of origin to country of destination.  

They may move to another country for a variety of reasons, including seeking better economic opportunities, reuniting with family members, fleeing persecution or conflict, or pursuing educational opportunities. Immigrants may also be referred to as migrants or foreign-born individuals.

The immigrants who can contribute to the nation will be given greater chances to stay is the statement that best paraphrases this text second..

Learn more about immigrants here:

https://brainly.com/question/10686874

#SPJ6

A psychrometer is used and the following temperatures are
recorded: DRY BULB: 22 C and the WET BULB: 14 C. The dew point
temperature would be:

Answers

The dew point temperature would be 16.8°C.

The dry bulb and wet bulb temperatures are both measured using a psychrometer. For these measurements, the dry bulb thermometer is usually exposed to the air and the wet bulb thermometer is covered in a wick saturated with distilled water. The dew point temperature can be calculated using the dry bulb temperature and the wet bulb temperature.

What is a psychrometer?

A psychrometer is a measuring device that is used to calculate relative humidity and dew point. The wet-bulb and dry-bulb thermometers are the two components of a standard psychrometer. Wet-bulb and dry-bulb thermometers measure temperature in two different ways: the dry-bulb thermometer measures the ambient air temperature, while the wet-bulb thermometer measures the lowest temperature that can be reached through evaporative cooling. What is the

Dew Point temperature?

The dew point temperature is the temperature at which a given amount of water vapor in the air will condense into a liquid state. It is the point at which air reaches a state of full saturation and can no longer hold any additional moisture. The formula for calculating the dew point temperature using the dry bulb and wet bulb temperatures is as follows: dp = T - ((100 - RH)/5)Where dp is the dew point temperature, T is the dry bulb temperature, and RH is the relative humidity. Using the formula, we can determine the dew point temperature as follows:dp = 22 - ((100 - 74)/5)dp = 22 - (26/5)dp = 22 - 5.2dp = 16.8°C

Therefore, the dew point temperature would be 16.8°C.

know more about psychrometer.

https://brainly.com/question/30750931

#SPJ11


Sara is a member of a debate group for her history class. they are only supposed to participate in one debate.

A. Reference
B.primary
C. secondary​

Answers

Answer: secondary

Explanation: took it

any two importance of human resources​

Answers

Answer:

human resources are important in the development of nation.it leads country in development process.

hope it is helpful to you

If you could go anywhere and do anything where would that be and why Explain ?

Answers

Answer:

I would go to all the places I havent been and I would want to work at nasa as a Deputy Director in engineering.

Explanation:

Which of the following represent the different types of outsourcing? (Check all that apply.)
a. nearshore outsourcing
b. scope outsourcing
c. onshore outsourcing
d. global outsourcing
e. offshore outsourcing
f. requirements outsourcing

Answers

The different types of outsourcing are  a. Nearshore outsourcing, c. Onshore outsourcing, d. Global outsourcing and e. Offshore outsourcing

Outsourcing is when a business hires a firm or independent contractor to complete tasks that are unrelated to its core business in the hopes of increasing efficiency. The available choices correspond to various geographical areas or regions where outsourced services are required. Nearshore outsourcing describes the practice of sending jobs or services to a nation that is close by or a neighbour.

The term "onshore outsourcing" refers to hiring professionals from the same nation or area. The term global outsourcing describes the outsourcing of services on an international scale, frequently encompassing many nations. When services are outsourced to a foreign nation, usually one with cheaper labor costs, it is known as offshore outsourcing.

Read more about outsourcing on:

https://brainly.com/question/30478133

#SPJ4

Which personality disorders was fromerly known as sociopathic?

Answers

The personality disorder that was formerly known as sociopathic is Antisocial Personality Disorder.

What is Antisocial Personality Disorder?Antisocial Personality Disorder (ASPD) is a type of personality disorder characterized by a persistent disregard for the feelings of others and a lack of empathy. Those who have ASPD are prone to violate the rights of others and to engage in criminal behavior. Furthermore, people with this condition are frequently deceitful, impulsive, and aggressive. To receive a diagnosis of Antisocial Personality Disorder, an individual must be at least 18 years old and have a history of conduct disorder.

ASPD is characterized by a pervasive pattern of disregard for and violation of the rights of others. Individuals with this disorder often display a lack of empathy, a tendency to engage in impulsive and irresponsible behavior, a disregard for societal norms, and a history of antisocial behavior.

Learn more about sociopathic: https://brainly.com/question/30399558

#SPJ11

Write an essay on the topic "unity in diversity:Characteristic of Nepalese society"​

Answers

Explanation:

Nepal is rich in traditions . people from different language culture caste religion and geographical backgrounds having their own unique traditions. But they have mutual cooperation understanding . they don't think or say negative things about others culture religion etc . that's why in Nepal unity in diversity is in maintained condition.

hope it is helpful to you

juvenile court matters fall into how many different categories of supervision?

Answers

Juvenile court matters fall into two different categories of supervision.

The explanation for this answer is that the juvenile court system typically categorizes cases into two main types of supervision: formal and informal. Formal supervision involves court-ordered mandates and oversight, such as probation or placement in a juvenile detention facility. Informal supervision, on the other hand, refers to less formal interventions, such as counseling, community service, or diversion programs, which aim to address the needs of the juvenile offender without involving court proceedings.

These two categories of supervision provide different levels of intervention and support based on the severity of the offense and the needs of the young individual involved.

You can learn more about Juvenile court at

https://brainly.com/question/11399114

#SPJ11

Maslow most clearly interjected his own personal values into his study of self-actualized individuals by: selectively studying people with qualities he admired selectively studying people with qualities he admired interpreting their flattering self-descriptions as a self-serving bias interpreting their flattering self-descriptions as a self-serving bias overemphasizing the value of their loyalty to cultural norms overemphasizing the value of their loyalty to cultural norms using projective tests to assess their motives

Answers

Answer:

The correct answer is ''selectively studying people with qualities he admired.''

Explanation:

Abraham Maslow was an American psychologist from the humanistic perspective, as far as psychological currents are concerned. Maslow believed that people develop through various levels towards their full potential. By studying people whom Maslow considered to be self-actualizing, psychologically healthy people were independent and self-accepting, had few conflicts, and could enjoy both leisure and work. Maslow discovered the 15 Essential Traits behavior, typical of individuals capable of dealing with intelligence, understanding and will, all kinds of situations in their daily life. According to Maslow, self-actualization is the ultimate achievement of the satisfaction of human needs. It is the development of human potential, self-acceptance, strengthening spirituality, knowledge, good interpersonal relationships and living under the concept of happiness. He considered that every human being was capable of achieving his own self-realization having previously satisfied his basic needs, which he exposed in his famous hierarchy of needs.

The composition of the sun is best described as..

A / liquid nitrogen and solid magnesium.

B / molten rock,primarily iron.

C / dense and composed of hot gases .

D / lightweight particles of dust .

Answers

I’m pretty sure it’s C I hope so

a storng culture of safety requires laboratory workers to integrate the identification, evaluation and mitigation of hazards true false

Answers

It is true that a laboratory environment has to combine the detection, assessment, and mitigation of dangers if there is to be a strong culture of safety.

The various needs of the professionals working there dictate how laboratories are set up and what they contain. A particle accelerator or vacuum chamber may be found in a physics lab, but a metallurgy lab would feature equipment for casting, refining, or testing metals for strength.

A wet laboratory assessment may be used by a biologist or chemical, while a psychologist would utilize a room with one-way mirrors and covert cameras to study behavior in their lab.

Computers (and even supercomputers) are sometimes used in laboratory, such as those that computer scientists frequently work in, for either simulations or data processing. various sorts of laboratories will continue be used by scientists in various disciplines. Engineers create, construct, and test technical items in laboratories as well.

Learn more about  laboratory, from :

brainly.com/question/27748008

#SPJ4

Abraham Maslow suggested that those who fulfill their potential have satisfied the need for
reciprocal determinism.
immediate gratification.
self-actualization.
free association.

Answers

The correct statement is: abraham maslow suggested that those who fulfill their potential have satisfied the need for self-actualization.

abraham maslow proposed a hierarchy of needs in his theory of human motivation, and he associated self-actualization with fulfilling one's potential. according to maslow, self-actualization represents the highest level of psychological development and personal growth. reciprocal determinism is a concept from social cognitive theory, proposed by albert bandura, which explains the interaction between a person's behavior, personal factors, and the environment. immediate gratification refers to seeking immediate satisfaction or pleasure without considering long-term consequences. free association is a psychoanalytic technique used in therapy where clients express their thoughts and feelings without censorship or judgment. these concepts are not directly associated with maslow's hierarchy of needs and self-actualization.

Learn more about interaction here:

https://brainly.com/question/31168969

#SPJ11

What is the best way to respond to a nonnative speaker who does or says things that are unexpected or seem out of place in the classroom? Ask the student questions and listen carefully. Call the student out and point to a peer who is modeling good behavior. Ignore the student, who is just acting smart and will tire of it soon. Send the student home with a note about the odd behavior.
no links!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Thanks for the information

suportte the speker and ask them what they whant to akomplesh

Q-6. List the different ways in which people criticise unjust laws. ​

Answers

Civil disobedience, legal challenges, advocacy, protests, media discourse, international pressure are some ways people criticize unjust laws.

1. Civil Disobedience:

People may choose to engage in civil disobedience as a form of protest against unjust laws. This can involve deliberate acts of non-compliance or peaceful demonstrations to challenge the legitimacy of such laws.

2. Legal Challenges:

Individuals or groups may take legal action to challenge unjust laws through the court system. They may file lawsuits or petitions, seeking judicial review to challenge the constitutionality or fairness of the law.

3. Advocacy and Activism:

People can criticize unjust laws by engaging in advocacy and activism. This involves raising awareness, mobilizing public support, and lobbying policymakers to change or repeal unjust laws.

4. Public Protests and Demonstrations:

Peaceful protests, marches, rallies, and demonstrations provide a platform for individuals and communities to voice their dissent against unjust laws, drawing attention to their concerns and demanding change.

5. Media and Public Discourse:

Criticism of unjust laws can occur through various media channels, such as newspapers, social media, and public debates. People can express their opinions, share stories, and engage in discussions to challenge the legitimacy and impact of unjust laws.

6. International Pressure:

In cases where unjust laws violate human rights or international norms, individuals or organizations can seek support from international bodies, engage in diplomatic efforts, and generate global pressure to condemn and rectify such laws.

By employing these various methods, people can actively criticize unjust laws, raise awareness, and work towards creating a more just and equitable legal framework.

For more such questions on Unjust laws:

https://brainly.com/question/15416517

#SPJ8

Use the image and fill in the blanks

Answers

Answer:

ScalawagsCarpetbaggersHiram Rhodes RevelsJim CrowfreecitizensvoteassistancestampSeparation of PowerstariffSouth Carolinafactory system

what is cultural intelligence? the ability to recognize emotions and discern between different feelings and label them appropriately the ability to effectively deliver services that meet the social, cultural, and linguistic needs of others the measure of one's ability to use information and logic to answer questions or make predictions

Answers

Cultural intelligence refers to the ability to effectively and appropriately interact and adapt to different cultural contexts.

It involves understanding and appreciating cultural differences, recognizing and respecting diverse norms, values, and behaviors, and being able to navigate and communicate effectively across cultural boundaries. Cultural intelligence encompasses a combination of knowledge, skills, attitudes, and behaviors that enable individuals to work and engage with people from different cultural backgrounds in a respectful and inclusive manner.

It goes beyond mere cultural awareness and includes the ability to adapt and adjust one's behavior, communication style, and decision-making processes to effectively engage with individuals and groups from diverse cultures. Cultural intelligence is crucial in promoting intercultural understanding, collaboration, and building meaningful relationships in today's globalized world.

To learn more about Cultural intelligence : brainly.com/question/30188245

#SPJ11

Explain the concept Constitution​

Answers

Answer:

A constitution is an aggregate of fundamental principles or established precedents that constitute the legal basis of a polity, organisation or other type of entity and commonly determine how that entity is to be governed.

You are the president of Silver Fiddle Construction (SFC), which specializes in building high-quality, customized homes in the Grand Junction, Colorado, area. You have just been hired by the Czopeks to build their dream home. You operate as a general contractor and employ only a part-time bookkeeper. You subcontract work to local trade professionals. Housing construction in Grand Junction is booming. You are tentatively scheduled to complete 11 houses this year. You have promised the Czopeks that the final costs will range from $450,000 to$500,000 and that it will take five months to complete the house once groundbreaking has begun. The Czopeks are willing to have the project delayed in order to save costs. You have just finished a preliminary scope statement for the project (see below). You are now brainstorming potential risks associated with the project.
Identify potential risks associated with this project. Try to come up with at least five different risks.
Use a risk assessment form similar to the Figure to analyze identified risks.
Develop a risk response matrix similar to the Figure to outline how you would deal with each of the risks.

Answers

The potential risks associated with this project are Weather-related Delays, Supply Chain Disruptions, Cost Overruns, Regulatory Compliance, and Quality Control Issues.

As the president of Silver Fiddle Construction (SFC), assigned the development undertaking for the Czopeks' dream domestic in Grand Junction, Colorado, calls for cautious consideration of capability dangers. Here are five dangers associated with the project:

Weather-related Delays: Unpredictable climate conditions inclusive of heavy rain, extreme temperatures, or extreme storms can obstruct production development, main to capacity delays in meeting the mission's timeline.

Supply Chain Disruptions: Dependence on external providers and subcontractors introduces the hazard of delays in fabric deliveries, hard work shortages, or subcontractor availability problems, which can impact venture scheduling and value control.

Cost Overruns: Despite the provided cost variety, unexpected occasions like modifications in fabric fees, scope changes, or unexpected site conditions can lead to cost overruns, exceeding the patron's price range and impacting assignment profitability.

Regulatory Compliance: Ensuring compliance with neighborhood construction codes, permits, and regulations is vital. Failure to satisfy these requirements can bring about fines, mission delays, and reputational damage.

Quality Control Issues: Maintaining excessive production standards is critical for client pleasure. Quality control problems, consisting of bad workmanship or defective materials, can result in transformation, additional prices, and potential disputes with the purchaser.

To examine and cope with these dangers, a threat evaluation form may be employed. This form should include a description of each diagnosed chance, an evaluation of its chance and capability effect, and proposed mitigation measures. This permits a systematic assessment of risks and enables knowledgeable choice-making.

Additionally, a hazard reaction matrix may be evolved to outline strategies for each identified risk. These techniques may additionally consist of preventive measures, chance transfer (together with coverage), chance mitigation via contingency plans or opportunity procedures, or chance reputation if the effect is deemed possible.

By proactively assessing and addressing potential risks, SFC can decorate challenge achievement by means of minimizing disruptions, optimizing fee management, ensuring regulatory compliance, and handing over an outstanding dream home to the Czopeks inside the agreed-upon time frame and price range.

To know more about risks management,

https://brainly.com/question/29710617

#SPJ4

Jorge is repelled by the smell and taste of milk. For this reason, he avoids all milk products because he perceives any product that contains milk as aversive. This scenario is an example of _____.
a) stimulus generalization
b) latent inhibition
c) overshadowing
d) blocking

Answers

The scenario described is an example of a) stimulus generalization.

What is Stimulus generalization

Stimulus generalization occurs when a response that is originally conditioned to a specific stimulus also occurs in the presence of similar stimuli. In this case, Jorge's aversion to the smell and taste of milk has generalized to all milk products. He avoids all milk products because he perceives them as aversive due to the similar sensory characteristics they share with milk.

Jorge's negative experience with the taste and smell of milk has led to a generalized avoidance response, where he extends his aversion to any product that contains milk

Read mroe on Stimulus generalization here https://brainly.com/question/31558092

#SPJ4

according to structural family therapy model, family structure refers to which of the following?

Answers

Answer: The rules that have been developed over the years to determine who interacts with whom.

Explanation:

Family structure. For Minuchin (1974), the structure of the family refers to the rules that have been developed over the years to determine who interacts with whom. Structures may be temporary or long-standing.

According to Structural Family Therapy model, family structure refers to D: The way families are organized into subsystems separated by emotional boundaries.

What is family structure ?

In the Structural Family Therapy model, family structure refers to the overall organization and arrangement of family members into subsystems and the boundaries that exist between these subsystems. These subsystems can include parent-child relationships, sibling relationships, or any other relationships within the family.

The concept of family structure in Structural Family Therapy emphasizes the importance of clear and flexible boundaries between subsystems.

Find out more on family structure at https://brainly.com/question/20455786

#SPJ 4

Full question is:

According to Structural Family Therapy model, family structure refers to which of the following?

A.Birth order.

B.How individuals in the family balance individuality and togetherness.

C.How individuals in the family experience and express their real feelings.

D.The way families are organized into subsystems separated by emotional boundaries.

provide three source of financial aid for learners to study after school​

Answers

Federal Financial Assistance
Federal Direct and FFEL Stafford Loans
Federal Pell Grants

True or false:
grandparents serving as parents to their grandchildren tend to neglect themselves due to the added stress.

Answers

The statement “grandparents serving as parents to their grandchildren tend to neglect themselves due to the added stress” is true because the responsibilities of parenting later in life can be physically and emotionally demanding.

Grandparents serving as primary caregivers to their grandchildren can experience added stress and often neglect their own well-being. Taking on the responsibilities of parenting later in life can be physically and emotionally demanding, which can lead to neglecting their own needs.

They may prioritize the needs of their grandchildren over their own, leading to self-neglect in terms of physical health, mental well-being, and social engagement. It is important for grandparents in such situations to seek support, both practical and emotional, to ensure they can care for themselves while also caring for their grandchildren, the statement is true.

To learn more about responsibilities follow the link:

https://brainly.com/question/29729388

#SPJ4

extinction is more effective when combined with other techniques that stimulate and simultaneously reinforce alternative appropriate actions such as positive reinforcement. true or false

Answers

Yes, the above statement is true. Extinction, which involves withholding reinforcement for a behavior, can be more effective when combined with other techniques that stimulate and reinforce alternative appropriate actions, such as positive reinforcement.

While extinction alone can reduce the frequency of a targeted behavior by eliminating the reinforcement associated with it, it may be more effective to teach and reinforce desired behaviors as an alternative. By using positive reinforcement to reward and encourage desirable behaviors, individuals are more likely to engage in those behaviors instead of the targeted behavior.

This combination of extinction and positive reinforcement can create a more comprehensive approach to behavior modification, promoting the development and maintenance of appropriate and desired actions.

To learn more about Extinction, click here:

https://brainly.com/question/31920386

#SPJ11

a. describe how differences in physical and behavioral traits can account for the differences in number of observations among organisms on inaturalist.

Answers

Differences in physical and behavioral traits among organisms can account for the variations in the number of observations on iNaturalist, an online platform for documenting and sharing biodiversity observations.

Organisms with certain physical traits or behaviors may be more noticeable or easily identifiable, leading to a higher number of observations. For example, charismatic species like large mammals or brightly colored birds are more likely to attract attention and receive more observations compared to less conspicuous organisms. Additionally, organisms with unique or rare behavioral traits may generate more interest from observers. Furthermore, certain traits, such as being active during daylight hours or being present in easily accessible locations, can increase the likelihood of being observed and recorded. Therefore, the differences in physical and behavioral traits influence the visibility, attractiveness, and accessibility of organisms, which subsequently affects the number of observations they receive on iNaturalist.

To learn more about  observations  click on the link below:

brainly.com/question/30125353

#SPJ11

Which is not one of Erik Erikson's eight psychosocial stages of development? Responses: Wisdom Wisdom Hopes Hopes Fidelity Fidelity Patience
a. Wisdom
b. Hopes
c. Fidelity
d. Patience

Answers

The correct option is a. Wisdom. While wisdom is not one of the stages, the theory provides a framework for understanding the psychosocial challenges individuals face as they progress through life.

Erik Erikson's theory of psychosocial development is based on eight stages that cover a person's lifespan, from birth to death. Each stage has its own unique crisis, which is a turning point in the person's life that they must overcome in order to develop a healthy personality.

According to Erikson's psychosocial development theory, each stage involves the individual's efforts to understand their surroundings and how they fit into the larger world. They'll be presented with a variety of obstacles and challenges that they'll need to overcome in order to achieve their aims and become successful in their lives.

The following are Erik Erikson's eight stages of psychosocial development:

Trust vs. Mistrust

Autonomy vs. Shame and Doubt

Initiative vs. Guilt

Industry vs. Inferiority

Identity vs. Role Confusion

Intimacy vs. Isolation

Generativity vs. Stagnation

Ego Integrity vs. Despair

Wisdom is not one of Erik Erikson's eight psychosocial stages of development.

In conclusion, Erik Erikson's theory of psychosocial development consists of eight stages that individuals go through during their lifespan. Each stage presents a unique crisis that must be overcome for healthy personality development. These stages involve efforts to understand one's surroundings and overcome obstacles and challenges.

To know more about, Wisdom  Visit :

https://brainly.com/question/30009007

#SPJ11

Answer:

d. Patience

Explanation:

Erik Erikson named eight psychosocial stages of development, naming each stage with its desired outcome. The stages are Hopes, Will, Purpose, Competence, Fidelity, Love, Care, and Wisdom.

Do changes in government affect students and how they live? If so, how?

Answers

yes because if they change school hours that effects sleep schedules

Two ways on how destructive relationships influence your well-being as opposed to constructive relationships

Answers

Answer:

Explanation:

Two ways how destructive relationships influence your well-being as opposed to constructive relationships.. Explanation: Destructive relationship occurs when one individual manipulates the other individual physically, emotionally and mentally causing great distress and disturbance.

Typically, within a constructive relationship, there's going to be more open communication, a willingness to sit down and talk about the issues, listen to the other party, perhaps take responsibility for something on your part that you did that you may have helped cause a conflict, a dispute, a misunderstanding.

Other Questions
Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=???? Which of the following expressions are equivalent to 10 12? Choose all answers that apply: . 2.5 - 6 B.2(5 - 6) C.None of the above Approximately how many Tejanos(Mexicans living in Texas) were livingthere around 1800?A. 3000B. 10,000C. 22,000