A, B & C lie on a straight line.
D, C & E lie on a different straight line.
Angle y= 107° and angle z = 56°.
Work out x

A, B & C Lie On A Straight Line.D, C & E Lie On A Different Straight Line.Angle Y= 107 And Angle

Answers

Answer 1

Answer:

x = 129°

Step-by-step explanation:

∠ ABD and ∠ DBC are a linear pair and sum to 180° , then

y + ∠ DBC = 180°

107° + ∠ DBC = 180° ( subtract 107° from both sides )

∠ DBC = 73°

the exterior angle of a triangle is equal to the sum of the 2 opposite interior angles , then

x = ∠ DBC + z = 73° + 56° = 129°


Related Questions

1 stick butter is equivalent to _____ ounces.

Answers

Answer:

4 ounces

Step-by-step explanation:

Answer:

1 stick butter is equivalent to __4___ ounces.

Step-by-step explanation:

1 stick of butter is equal to 4 ounces

how do you find the breadth of the area in a square

Answers

Answer:

A = l x b

Step-by-step explanation:

Area = length x breath

So find the area and length and work it out by dividing area by length.

Mr. Mason paints his fence on Monday, Tuesday, Wednesday, and Thursday. It takes him a total of 6 2/4 hours to paint his fence. Write a digit in each box to show how many hours he could have painted each day.

Answers

A fraction is a way to describe a part of a whole. The number of hours that Mr Mason painted each day is 1.625  hours.

What is a Fraction?

A fraction is a way to describe a part of a whole. such as the fraction ¼ can be described as 0.25.

The total number of hours that Mr Mason took to paint the fence is 6 2/4 hours, while the number of days taken by him is 4 hours. Therefore, the number of hours for which Mr Mason painted each day can be written as,

= (6 ²/₄)/4

= (26/4)/4

= 26/16

= 1.625 hours a day

Hence, the number of hours that Mr Mason painted each day is 1.625  hours.

Learn more about Fraction:

https://brainly.com/question/1301963

#SPJ1

If f(x)=3x-2 and g(x)=2x+1,find (f+g)(x)

Answers

Answer:

f(x) + g(x) = 3x - 2 + 2x + 1

(f + g)(x) = 5x - 1

Describe the error in solving the equation -2x^2+9x=4 using the Quadratic Formula.

Answers

Answer:

The roots are 0.5 and 4.

Step-by-step explanation:

-2x^2+9x=4

Rearrange:

-2x^2 + 9x - 4 = 0

x = [-b +/- √(b)^2 - 4ac)] / 2a

Using this quadratic formula the solution is:

x = [-9 +/- √(9)^2 - 4*(-2)*(-4)] / (2*-2)

   = (-9 +/- √49) / -4

   = 9/4 +/- (-7/4)

   = 9/4 - 7/4 = 0.5

and 9/4 + 7/4 = 4

Members of a soccer team raised $1511 to go to a tournament. They rented a bus for $933.50 and budgeted $38.50 per player for meals. Determine the number of players the team can bring to the tournament.

hurry pls

Answers

Answer = 15 players

Total $ = ($per player)(x players) + set cost
$1511 = 38.50 X + 933.50

$1511 = 38.50x + 933.50

Solve for x
Subtract 933.50 from both sides to combine like terms
$577.50 = 38.50 x
Now divide both sides by 38.50 to isolate x
15 = x

The number of players in the team would be 15 which can bring to the tournament.

A soccer squad collected $1511 to attend a competition. They spent $933.50 on a bus rental and $38.50 for each player on food.

What is a numerical expression?

A numerical expression is an algebraic information stated in the form of numbers and variables that are unknown. Information can is used to generate numerical expressions.

Let the number of players would be x

As per the given information, the required solution would be as:

Total budget = (per player meal)(x players) + bus rent

1511 = 38.50x + 933.50

Rearrange the terms and solve for x

1511 - 933.50 = 38.50x

577.50 = 38.50 x

Divide both sides by 38.50 into above equation,

x = 15

Therefore, the number of players in the team would be 15 which can bring to the tournament.

To learn more about numerical expression click here :

https://brainly.com/question/6037813

#SPJ2

What is the area of the triangle formed from 0,-1), (0.4), and
(4,-1)?
OA. 20 square units
B. 5 square units
O C. 40 square units
O D. 10 square units

Answers

Answer:

  D.  10 square units

Step-by-step explanation:

The area of a triangle is given by the formula ...

  A = 1/2bh

__

This triangle has a base of 4 units and a height of 5 units. (These dimensions can be counted from the graph, or found by subtracting coordinate values.) Its area is ...

  A = 1/2(4 units)(5 units) = 10 square units

_____

Additional comment

The first two coordinates lie on the line x=0. The length of that segment is the difference of the y-values: 4 -(-1) = 5.

The first and last coordinates lie on the line y=-1. The length of that segment is the difference of the x-values: 4 -0 = 4.

Market research shows that 30% of consumers are likely to purchase an electronic tablet for younger children under age 10. However, only 2% of consumers are likely to buy a laptop for children under the age of 10. On the other hand, for children ages 10 – 17, 50% of consumers are likely to buy a tablet and 40% are likely to buy a laptop. If a family has a five-year-old son and a 13-year-old daughter, what is the probability of both children receiving a tablet?

Answers

Answer:

see the attachment photo!

-2 (3d - 5d²) simplify

Answers

Answer: =-6d+10d^2

Step-by-step explanation:

During a game of golf, Kayley hits her ball out of a sand trap. The equation h = t? + 4t -
21 models the height of the golf ball in feet in relation to the number of t seconds since it was hit. Kayley solved the quadratic by factoring: .
a. How many seconds does it take for her ball to reach the green?
b. How do we know the 2nd value isn't also a solution?

Answers

A quadratic equation is in the form of ax²+bx+c. It took 3seconds for the golf ball to reach the green.

What is a quadratic equation?

A quadratic equation is an equation whose leading coefficient is of second degree also the equation has only one unknown while it has 3 unknown numbers. It is written in the form of ax²+bx+c.

A.) The time that the ball takes to reach the green can be found by equation the equation against zero. As the ball will have 0 height when it will be on the green,

t²+4t-21=0

t²+7t-3t-21=0

t(t+7)-3(t+7)=0

(t+7)(t-3)=0

t = -7, 3

Hence, it took 3seconds for the golf ball to reach the green.

B.) Since the time can not be negative the second value is wrong.

Learn more about Quadratic Equations:

https://brainly.com/question/2263981

#SPJ1

-7x + 13 > 41 what is the answer

Answers

Answer:

x < -4

Step-by-step explanation:

-7x>28

7x<-28

x<-4

please give brainliest!

hope this helps :)

The great pyramid of giza has a square base. the length of each side of the base is approximately 230 meters. the height of the pyramid is approximately 147 meters. using these dimensions, what is the volume, in cubic meters, of the pyramid?

Answers

Answer:

  2,592,100 m³

Step-by-step explanation:

The volume of the pyramid can be found by using the given dimensions in the formula for the volume of a square pyramid.

__

formula

  V = 1/3s²h

where s is the side length of the square base, and h is the height.

application

Using the given dimensions, s = 230 m, h = 147 m, we find the volume to be ...

  V = 1/3(230 m)²(147 m) = 2,592,100 m³

The volume of the pyramid is 2,592,100 cubic meters.

Don’t know how to solve.

Answers

Answer:

$122.88

Step-by-step explanation:

the phone decreases by 20% each year , that is

(100 - 20)% = 80% = [tex]\frac{80}{100}[/tex] = 0.8

the phone reduces by a factor of 0.8 each year , then after 4 years

value = $300 × [tex](0.8)^{4}[/tex] = $122.88

what is the perimeter of the triangle

Answers

32. 8+8 is 16 and the base is 16

Select the correct answer.
The Cohen family started their wheat farm in 1995. The equation models the number of bushels of wheat they produced each year, where t
is the number of years since 1995.
C(t) = 7,000+500 In(t+1)
The Mason family also started their wheat farm in 1995. The graph models the number of bushels of wheat they produced each year, where t
is the number of years since 1995.
M(1)
12,000
8,000
4,000
-24-168
16 24
4,000
-8,000+
12,000
Which statement is true about the quantity of wheat the two farms will produce as the years pass?
OA The wheat production of both farms will continue to increase each year without bound.
OB. The Cohen farm's wheat production will continue to increase each year without bound, while the Mason farm's wheat
production will approach a stable amount.
OC. The Mason farm's wheat production will continue to increase each year without bound, while the Cohen farm's wheat
production will approach a stable amount.
O D.
The wheat production of both farms will approach a stable amount as the years pass.

Answers

The wheat production of both farms will approach a stable amount as the years pass.

What is an exponential function?

An exponential function is one that is steadily increasing or decreasing. We can see that in this case there is a positive sign indicating an increase.

Thus, from the graph, we can see that, the wheat production of both farms will approach a stable amount as the years pass.

Learn more about exponential function:https://brainly.com/question/11487261

#SPJ1

Which expression is equivalent to startfraction startroot 10 endroot over rootindex 4 startroot 8 endroot?

Answers

The expression that is equivalent to √10 / (4√8) is given as √5 / 8

What is an equation?

An equation is an expression that shows the relationship between two or more variables and numbers.

Given the equation:

√10 / (4√8)

Simplifying:

= √10 / (4√(4 * 2))

= √10 / (8√2)

= √5 / 8

The expression that is equivalent to √10 / (4√8) is given as √5 / 8

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

Quadrilateral RSTU is a rectangle and m/RVU = 72°.

What is m/VRU?

Answers

Answer: [tex]18^{\circ}[/tex]

Step-by-step explanation:

In triangle RUV, angle RUV is a right angle (and thus measures 90 degrees), and angle RVU measures 72 degrees.

Since angles in a triangle add to 180 degrees, angle VRU measures

180-90-72=18 degrees

Question 5 of 10
What is the surface area of the cube below?
OA. 20 units²
B. 8 units²
C. 24 units²
OD. 12 units²
SUBMIT

Answers

Answer:

S=6a^2

S=6×2^2

S=6×4=24

The right answer is C

Answer:

24 units²

Explanation:

The surface area of cube is 6(side)²

Here given:

a = 2

The surface area:

= 6(2)^2

= 6(4)

= 24

In class 8 A, there are 20 students, 55% students are present on Wednesday. Find out how many people are present that day? How many people are absent on that day?​

Answers

Answer:

11 students are present and 9 are absent.

The profit from a business is
described by the function
P(x) = -5x² + 30x + 8, where x
is the number of items made,
in thousands, and P(x) is the
profit in dollars. How many
items will maximize the profit?

Answers

First of all we will understand the question!!

The question is saying that you are given a function and you have to find the value of x which will give the maximum profit... Lets solve it by finding the extrema using the vertex

[tex] \rm \: p(x) = - 5 {x}^{2} + 30x + 8[/tex]

Identify the coefficients a and b of the quadratic function

[tex] \rm \: p(x) = { - 5x}^{2} + 30x + 8 \\ \rm \: a = - 5 \: and \: b \: = 30[/tex]

Since a<0, the function has the maximum value at x, calculated by substituting a and b into x=-b/2a

[tex] \rm \: x = \frac{30}{ 2 \times (- 5)} [/tex]

Solve the equation for x

[tex] \rm \: x = 3[/tex]

The maximum of the quadratic function is at x=3

Could anyone give me the answer to this question?

Answers

Answer:

36

Step-by-step explanation:

[tex]\angle AOC[/tex] is made up of s + r, and since r is [tex]\frac{3}{5}[/tex] of [tex]\angle AOC[/tex] we know r must be the remaining [tex]\frac{2}{5}[/tex] of [tex]\angle AOC[/tex].

We can solve for [tex]\angle AOC[/tex] by using this equation:

[tex]\frac{2}{5}\angle AOC = 24\\(\frac{2}{5}\angle AOC)\frac{5}{2} = (24)\frac{5}{2}\\ \boxed{\angle AOC = 60}[/tex]

1. 2 fifths of  [tex]\angle AOC[/tex] is 24

2. multiply both sides by [tex]\frac{5}{2}[/tex] to isolate [tex]\angle AOC[/tex]

3. [tex]\angle AOC[/tex] is 60°

We can now solve for r

[tex]r = \frac{3}{5}\angle AOC\\r = \frac{3}{5}(60)\\\boxed{r = 36}[/tex]

1. the equation the problem gave us

2. substitute [tex]\angle AOC[/tex] for 60 (we solved for it before)

3. [tex]r[/tex] is 36°

what is the square root of x divided by the square root of 2 equal

Answers

Answer:

[tex]\sqrt{\frac{x}{2} }[/tex]

Key:

• [tex]\frac{\sqrt{a}}{\sqrt{b}}=\sqrt{\frac{a}{b}}[/tex]

Step-by-step explanation:

[tex]\frac{\sqrt{x}}{\sqrt{2}}\\[/tex]

[tex]\frac{\sqrt{x}}{\sqrt{2}}=\sqrt{\frac{x}{2}}\\[/tex]

[tex]=\sqrt{\frac{x}{2}}[/tex]

The measures of all of the interior angles of a triangle are in the extended ratio 1 : 2 : 3. The value of the smallest angle is:

Answers

Answer:

30 degrees

Explanation:

Let the ratio's be in x, 2x, 3x

Total Interior Angle of a triangle sum ups to 180°

x + 2x + 3x = 180°6x = 180°x = 180°/6 = 30°

The smallest angle which is x is 30°

What is the next fraction in this sequence? Simplify your answer.
13/23, 1/2, 10/23, 17/46,
...
Submit

Answers

Answer:

7/23

Step-by-step explanation:

Each answer is 1.5/23 less than the previous

17/46  - 1.5/23 =   17/46 - 3/46 = 14/46 = 7/23


Ari said there are three possible outcomes when you
spin this spinner twice: two reds, a yellow and a red,
or two yellows.

So, the probability of getting two yellows is 1/3
Do you agree or disagree? Explain your thinking


Please answer fast :(

Answers

Answer: I disagree. The answer is 1/4

========================================================

Reason:

Ari hasn't considered the case of "red and yellow" which is almost identical to "yellow and red".

It helps to lay out a two by two table. Along the rows and columns, you'll have "red" and "yellow". See below.

Then inside the table are the list of all outcomes in the form (x,y) where x is the horizontal component along the columns, and y is the vertical component along the rows.

Example: if x = red and y = red, then we have the outcome (x,y) = (red, red)

As the table shows, we have 4 outcomes. Therefore the probability of getting two yellows is 1/4

Technically the (red, yellow) = (yellow, red) since ultimately order doesn't matter in this case. For some probability problems, order will matter. But again, order doesn't matter here and it means that we can treat these two situations the same. So I can see why Ari thinks there are only three outcomes.

--------------------------------

Here's another way to look at it:

The probability of landing on yellow is 1/2 assuming red and yellow are equally likely.

This means the probability of two yellow in a row is (1/2)*(1/2) = 1/4

Each is spin is independent of any other.

(2,-9) and (-3,6) in slope intercept form

Answers

Answer:

2 - 9 - 36

= - 43

Step-by-step explanation:

(hope it's Help)

The hypotenuse of a right triangle measures 17 cm and one of its legs measures 13 cm. Find the measure of the other leg. If necessary, round to the nearest tenth.

Answers

Step-by-step explanation:

13^2 + x^2 = 17^2

169 + x^2 = 289

289 - 169 = 120

x^2 = 120

[tex] \sqrt{120} = 10.9544511501[/tex]

x = 11.0

A timer is started and a few moments later a model airplane is launched from the ground. Its height (in feet) as a function of time (in seconds after the timer was started) is given by the equation h(t)=−(t−12)2+81

. Which of the following statements is true?

The airplane reaches its minimum height of 12 feet in 81 seconds.
The airplane reaches its maximum height of 81 feet in 12 seconds.
The airplane reaches its minimum height of 81 feet in 12 seconds.

The airplane reaches its maximum height of 12 feet in 81 seconds.

Answers

The statement which is true is the airplane reaches its maximum height of 81 feet in 12 seconds.

Since the height of the plane is a function given by a parabola, we need to know the equation of a parabola in vertex form

What is the equation of a parabola in vertex form?

The equation of a parabola with vertex (h,k) is given by y = a(x - h) + k

Since the height (in feet) of the airplane as a function of time (in seconds after the timer was started) is given by the equation h(t) = −(t − 12) + 81

Since this is the equation of a parabola in vertex form, comparing h with y, we have that a = -1, h = 12 and k = 81Since a = -1 < 0 this implies that the point (h, k) = (12, 81) is a maximum point

So, the statement which is true is the airplane reaches its maximum height of 81 feet in 12 seconds.

Learn more about equation of a parabola in vertex form here:

https://brainly.com/question/17684824

#SPJ1

Which equation can be simplified to find the inverse of y=x^2-7

Answers

The answer is X=Y^2-7
You just switch X with Y

write a polynomial that represents the length of the rectangle

help please !!

Answers

Answer:

[tex]\textsf{Length}=0.8x^2-0.7x+0.7\quad \sf units[/tex]

Step-by-step explanation:

Area of a rectangle = width × length

Therefore, to find the length of the rectangle, we need to divide the area by the width.

Using long division:

[tex]\large\begin{array}{r}0.8x^2-0.7x+0.7\phantom{)} \\x+0.5{\overline{\smash{\big)}\,0.8x^3-0.3x^2+0.35x+0.35\phantom{)}}}\\-~\phantom{(}\underline{(0.8x^3+0.4x^2)\phantom{-b))))))))))))))}}\\0-0.7x^2+0.35x+0.35\phantom{)}\\ \underline{-~\phantom{()}(-0.7x^2-0.35x)\phantom{-b)))))}}\\ 0.7x+0.35\phantom{)}\\\underline{-~\phantom{()}(0.7x-0.35)}\\ 0\phantom{)}\end{array}[/tex]

Therefore, the length of the rectangle is:

[tex]0.8x^2-0.7x+0.7[/tex]

Other Questions
Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map