A person would never have pure water put into their veins in a hospital because their cells would what?

Answers

Answer 1

Answer:

causes your blood cells to become hypotonic, possibly leading to death.

Explanation:

Answer 2

Saline water is always used to put into the veins of the patients. Pure water is never used for the purpose:

Saline water is isotonic to the cells in the body.Pure water is hypotonic to the cells in the body.The cells when placed in a hypotonic solution will swell up due to the influx of water inside the cells and will ultimately burst.

Thus, freshwater is never used to put in the veins of a person as it will make his cells burst.

https://brainly.com/question/894645


Related Questions

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.

Answers

Answer: The invasive species unbalance an ecosystem because it takes over an ecosystem and does not let the other native species thrive while it takes over. There are many invasive species around the world even in your own town or state there is a type of fish suppose that is an invasive species to Michigan called a sea lamprey which kills fish native  to the great lakes and is taking over there are also zebra muscles if you need another example

BRAINLIEST PLZ

            Invasive species lack native species' population controls, such as predators, because they did not co-evolve with the other species in the ecosystem. As a result, the population of an invasive species may spread unchecked and eventually throw an ecosystem out of balance.

Unbalances in ecosystem :

                 A natural or human-caused disruption that throws off an ecosystem's natural balance is known as an ecological imbalance. Both natural and man-made disturbances have the potential to upset an ecosystem's delicate balance. A species' extinction or the introduction of a new species may cause an ecosystem to become ecologically unbalanced.

                 All the organisms and the physical setting they interact with make up an ecosystem. The nutrition cycles and energy flows connect these biotic and abiotic elements. Photosynthesis is how energy enters the system and is absorbed by plant tissue. Both internal and external influences influence ecosystems. External variables that do not directly affect an ecosystem, such as topography, parent material that creates the soil, and climate, control the ecosystem's general structure. For instance, decomposition, root competition, shade, disturbance, succession, and the kinds of species present all regulate internal variables. While the availability of these resources within the ecosystem is normally governed by internal factors, the resource inputs are often controlled by external activities. As a result, interior variables influence ecological processes as well as being influenced by them.

To learn more about ecosystem refer :

https://brainly.com/question/842527

#SPJ2

11. Peripheral membranes are located

Answers

Answer:free point

Explanation:

The answer for the question is free point

Why are online banks becoming more popular?

Answers

Answer:

Online banks are becoming more popular because people don't want to get out of there house and also because of the virus

Explanation:

Hope this helps an also can I have a brainliest

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

The last universal common ancestor (LUCA) probably multiplied by duplicating all of its cellular contents, followed by cellular division .

Answers

Answer: true

Explanation:

i guessed and got it right

which factor would increase the production of glucose by photosynthesis

Please help!!!

Answers

Answer:

freezing temperatures

The amount of sun it’s getting

How is the DNA code itself a homology?

Answers

Answer:

Explanation:

These fundamental similarities are most easily explained by evolutionary theory: life shares a common ancestor. ... In fact, the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Answer:

the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Which is the outcome of a mass of cells in the lungs?

A. The lungs will stop working.
B. This will not affect the lungs.
C. The lung's capacity for oxygen will be positively affected.
D. The lung's capacity for oxygen will be negatively affected.

Answers

D. The lung's capacity for oxygen will be negatively affected.

The lung has a capacity of a about 5L this will decrease becuase the mass will obstruct the airway.

Answer:

D. The lung's capacity for oxygen will be negatively affected.

Explanation:

can all organisms respond to stimuli?

Answers

Answer:

I believe all living organisms can

Explanation:

Yes, all living organisms are able to respond to stimuli in their environment (stimuli= temps, gravity, and lighting)

someone Please help!! I'm not good at this stuff. I'll give brailniest

Answers

Answer:

What do you need help with?

Explanation:

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

what was the problem with reusing contaminated water from other parts of the mill to extinguish the coke fires? From the book ‘When smoke ran like water’

Answers

Answer:

1. The problem with that was that the already poisonous water was made worse after using it to quench the flames from coke production.

2. It contaminated the soil, making it difficult for plants to grow.

Explanation:

As the author described the last stages of coke production, she explained that water was needed to quench the very hot flames from coke production. A 'bright fellow' suggested using dirty water from other parts of the mill to quench the flames from the coke production. The problems with this were;

1. The already contaminated water was made worse after it was used to quench the flames from coke.

2. Mrs. LaMendola noted that she was unable to grow her tomatoes in the path where the plumes from the oven ran. So the contaminated water negatively affected the soil.

The problem that should be already poisonous water is also made worse when it quenches the flames at the time when the production of the coke should be done.

Also, it contaminated the soil also it is difficult for growing the plants.

The problem of reusing contaminated water:

Since the author explained the last coke production stage so here the water required to quench that it should be very hot flames arise from the coke production. Also, the contaminated water should be worse whenever it is used for quenching the flames. Also, the contaminated water does not positively impact the soil.

Learn more about water here: https://brainly.com/question/18850280

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

2. Tell the difference between the following
- Llittoral zone/limnetic zone
- photic/aphotic zone
- lake/wetland
- freshwater marsh/swamp/bog
- intertidal/neritic/open ocean zone

Answers

Answer:

1. littoral zone is a zone where lives continue after dead.

2. Photic zone is the zone where light Ray's give out to all plants.

2b. aphotic zone is a zone below where light absent.

3. Lake/wetland is a part of land where water is cover or absolutely moist in it nature.

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:


Which type of energy
does respiration release?
chemical
thermal
potential
kinetic

Answers

Answer:

Respiration releases energy it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

chemical

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

What traits might transfer across generations within animal species?

Answers

biological fitness or darwinian fitness there the same thing

What are the two categories that Igneous Rocks can be classified into?
How do you tell them apart?

Answers

Igneous rocks are divided into two groups, which penetrate or expand, depending on the strength of the molten rock.

Intrusive Igneous Rocks: Intrusive, or plutonic, is an empty rock that occurs when magma is trapped in the depths of the Earth.Extrusive, or volcanic, igneous rock is produced when magma exits and cools above the Earth's surface.

hope it helps!

Help me ASAP please

Answers

Answer:

C

Explanation:

Who were the representatives
sent to work on the deal?

Answers

Answer:

Peace Negotiations

After Yorktown, the Continental Congress appointed a small group of statesmen to travel to Europe and negotiate a peace treaty with the British: John Adams, Benjamin Franklin, John Jay, Thomas Jefferson and Henry Laurens.

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

Joseph and Molly each have coin collections. Joseph starts with 15 coins in his collection and adds 25 coins each month. Molly starts with 25 coins in her collection and adds 25 coins each month. If Joseph and Molly continue to collect in this way, how many coins will each person have after 10 months? Enter your answers in the boxes. After 10 months, Joseph will have coins in his collection, and Molly will have coins in her collection.

Answers

Answer:

Joseph will have 265 coins and Molly will have 275 coins after ten months.

Explanation:

Joseph already has 15 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]15+25\times 10=265[/tex] coins.

Molly already has 25 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]25+25\times 10=275[/tex] coins.

So, Joseph will have 265 coins and Molly will have 275 coins after ten months.

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

Which one is it I need help?

Answers

answer a is correct

describe some of destructive action of microbes ​

Answers

Answer:

A microbe is a small living thing too tiny to be seen by the naked eye and includes bacteria, fungi and viruses. Among their destructive actions is causing diseases in human beings and their livestock or plants, destruction of food by causing decomposition which might lead to hunger and other related calamities. Despite this destructive consequences, microbes are also known to have advantageous actions like helping in sewerage treatment, microbes found in the gastro-intestinal tract help in maintaining a good environment for digestion to take place. Microbes also help in ecological balance by causing decomposition of dead matter hence conserve the environment.

Explanation:

Answer:

see the attached photo

Other Questions
How might a Roman gentleman like Cato rise in politics? A 1369.4 kg car is traveling at 28.9 m/s when the driver takes his foot off the gas pedal. It takes 5.1 s for the car to slow down to 20 m/s. How large is the net force slowing the car C. "Extravagant in feast, festival and other occasions obstructs thedevelopment of society." Do you agree with the statement? Write your opinion. Perspective can help you present a realistic, true-to-life representation in a design. Discuss the possible uses of perspective in a design. When molecules are evenly dissolved or mixed throughout, it is known as a___ plz help Irradiation uses ionized radiation to preserve food and to prevent it from spoiling.FalseTrue Triangle A(1, 1), B (4,4), C (6,2) is a: I need this please also the directions are in the photo How do I solve for x 12 hungry friends see 8 cupcakes sitting b.on the table. If they split the cupcakesequally, how many does friend each get?12 other friends are told they can eat 0.8 cupcakes each. How many total cupcakes do these 12 friends eat? I already got the answer for the first question, but i only want to know how to do the next question, I do NOT want the answer. Thanks! A ladder is 8 meters long. It leans against a wall with one end on the ground, 6 meters from the wall. The other end reaches a windowsill. Calculate the height of the window sill above the ground. Which of the following bonds would be the most polar without being considered ionic? a. Mg-o b. C-O C. N-O d. Si-O PLS HELP I WILL GET MY AS$ beAtSection 1: Selected Response - Question 2Which equation or equations are true?1.) 3/10 + 15/100 = 18/1002.) 4/10 + 32/100 = 72/1003.) 7/10 + 2/100 = 27/1004.) 6/10 + 27/100 = 87/100AEquation 1 onlyBEquation 2 onlyCEquations 3 and 4 onlyDEquations 2 and 4 only Please help! ASAP! I will give brainliest!!Tara works at a call center for a home shopping network. The table below shows the number of orders placed with the network per day based on the number of calls received per day by the network.Number of Calls, x 200 250 300 350 400Number of Orders, N 170 225 272 326 374Which equation best models this set of data?A. N = x2 - 27B. N = -x2 + 27C. N = -x + 27D. N = x - 27 Which inquality is graft below? -5/6 divide by 9/10 HELP ASAP Which of the following makes a true statement?The country with the highest amount of gold reserves is in Africa.The country with the highest amount of gold reserves is in North America.No country in North America has a significant amount of gold reserves.No country in Africa has a significant amount of gold reserves. (Brainliest) Where was the Confederates last stand just before they surrendered?Appomattox, VirginiaPort Hudson, LouisianaGettysburg, PennsylvaniaVicksburg, Mississippi Will mark brainliest for whoever answers There are 7 flavors of ice cream available at an ice cream shop. This shop also has 2 different kinds of cones (waffle and plain). How many different combinations of 1 cone and 1 flavor of ice cream can you have?