Are reserved powers only for the States?

Answers

Answer 1

It is referred to as having "reserved powers" when the Constitution does not expressly provide certain powers to the federal government. These rights belong to the states under the Tenth Amendment.

Who is covered by restricted rights?

The Constitution reserves all other powers, either to the States individually or to the people, and neither grants them to the United States nor prohibits them from being granted to the States.

Exist any reserved powers for local governments?

State and local governments share the people's rights and the federal government's reserved powers, which belong to the states and the people.

What legal authority does a municipal government have?

Having a wide range of authority, local governments can offer services, sign contracts, and control who can own what. The municipal government may perform these tasks or through delegation 

To know more about state powers visit:

https://brainly.com/question/29067046

#SPJ4


Related Questions

What are the traditional values?

Answers

Answer:

Traditional values are your responsibilities to your family, your spouse, your parents, your children, and your society; IT is your knowledge and your work.

Explanation:

In a regulation volleyball game, how many players are on each side of the court?

Answers

In a regulation volleyball game, six(6) players are on each side of the court.

Volleyball is considered as a group activity where two groups of six players are isolated by a net. Each group tries to score focuses by establishing the ball in the other group's court under certain coordinated rules. It has been defined as a piece of the authority program of the Late spring Olympic Games since Tokyo 1964. Ocean side volleyball was acquainted with the program at the Atlanta 1996. The adjusted rendition of the volleyball at the Mid year Paralympic Games is sitting volleyball.

The total arrangement of rules is considered extensive, however play basically continues as keeps: a player in one of the groups starts a 'rally' by serving the ball (by throwing or delivering it and then afterward hitting it via hand or via arm), from behind the back limit line of the court, over the net, and into the accepting group's court. The getting group should not allow the ball to be grounded inside their court. The group might finish the ball up to various times to return the ball to the opposite side of the court, yet individual players may not touch the ball two times sequentially.

Hence, number of players are six(6).

To know more about volleyball, visit here:

https://brainly.com/question/14243282

#SPJ4

you are working on a group project with three other students, who appear to already be friends. you have some suggestions you would like to make, but decide to just follow the other members' ideas, because you do not believe your ideas would be accepted. this illustrates which type of barrier to problem solving?

Answers

This exemplifies an emotional obstacle to issue resolution, so the adage goes.

When does someone become a friend?

Once you and the individual have a lot of the same interests as well as comparable values, you become friends. Additionally, you genuinely get along really well. The "pull factors" that cause both both to draw toward one another and maintain the connection are your common beliefs and interests.

What is a best friend, in plain English?

A friend is someone you appreciate beyond all the other pals in your life, person you like spending time with, somebody you can confide in, and so on.

To know more about Friends visit:

https://brainly.com/question/17950268

#SPJ4

The complete question is-

You are working on a group project with three other students, who appear to already be friends. You have some suggestions you would like to make, but decide to just follow the other members’ ideas, because you do not believe your ideas would be accepted. This illustrates which type of barrier to problem solving?

a. emotional

b. cultural

c. learned

d. perceptual

What do you call the process of drawing inferences or conclusions through the use of reason?

Answers

Deductive reasoning is the process of drawing inferences or conclusions through the use of reason.

In deductive reasoning, the conclusion is established on the conformity of several premises that are normally taken to be genuine. It's also known as top-down logic when applied to deductive reasoning. The cornerstone of deductive reasoning is the creation of logical premises and the development of a conclusion from those premises. It does not depend on drawing conclusions and then presuming that those conclusions are correct. Deductive reasoning is a crucial general talent for people of all types since it enables one to draw conclusions from at least two pieces of information that one may be reasonably confident in.

Learn more about deductive reasoning here:

https://brainly.com/question/6651188

#SPJ4

Find the odd one out from the following options:

A. Collateral, Interest rate, Documentation requirement, Mode of repayment

B. Cooperatives, State Bank of India, Punjab National Bank, Canara Bank

C. Landlords, Money lenders, Relatives, Traders

D. Currency, Coins, Demand Deposits, Cheque
Please explain the reasoning behind your answer as well.

Answers

The Odd option is "Landlords, Money lenders, Relatives, Traders". The Option C is correct.

How is the Option C odd?

The list of "Landlords, Money lenders, Relatives, Traders" does not have relation unlike the Loan subject in (A. Collateral, Interest rate, Documentation requirement, Mode of repayment), Financial institution subject in (B. Cooperatives, State Bank of India, Punjab National Bank, Canara Bank) and money subject in (D. Currency, Coins, Demand Deposits, Cheque).

Therefore, we will agree that list of "Landlords, Money lenders, Relatives, Traders" have no common relation.

Read more about Relation

brainly.com/question/28853441

#SPJ1

What similarities and differences do you notice between Napoleon and Snowball?

Answers

Based on the book Animal Farm, the similarities and differences that are noticed between Napoleon and Snowball are: similarities in species and differences in ideas.

What is the book Animal Farm?

Animal Farm is generally considered a beast fable, that was written in a satirical allegorical novella, by George Orwell.

The ebook which was first published in England on 17 August 1945, tells the story of a group of farm animals who rebel against their human farmer, hoping to establish a society where the animals can be equal, unrestricted, and delighted.

However, in the book, there are characters called Snowballs and Napoleon, each having similarities and differences.

The similarity between Napoleon and Snowball are: They both thought that after eliminating the people, the farm should be reorganized.Also, they are both considered the same species, with a similar pure pose, good leadership characteristics, and outspokenness and intelligence.

Differences between Napoleon and Snowball are: While Napoleon focuses on the now, Snowball is a leader who was thinking about the future of his country. Napoleon has larger but Snowball is more articulate and able to come up with great ideas.

Hence, in this case, it is concluded that Napoleon and Snowball have varying similarities and differences.

Learn more about Animal Farm here: https://brainly.com/question/11752825

#SPJ1

What are the 3 classification levels of information?

Answers

According to EO 12356, there are three classification levels for information systems in the United States: Top Secret, Secret, and Confidential.

Material that a government agency regards to be sensitive information that has to be protected is classified information. Laws and regulations limit access to specific groups of people with the required security clearance and need to know, and improper handling of the information can result in criminal consequences.

In order to see or handle classified material, a formal security clearance is necessary. A thorough background check is necessary for the clearance process. Documents and other material must be appropriately labeled "by the author" with one of various (hierarchical) sensitivity levels, such as restricted, confidential, secret, and top secret.

Learn more about "  levels of information " to visit here;

https://brainly.com/question/17280437

#SPJ4

Armena must read and summarize a physics research article for a class assignment. The article discusses the standard error of measurement, which she is not familiar with. Which is the best resource for armena to consult?.

Answers

Armena must read and summarize a physics research article for a class assignment. The article discusses the standard error of measurement, which she is not familiar with.

The most reliable, pertinent, and accurate source of information on "the standard error of measurement" is a college textbook, which Armena should use as her primary source. Finding a source on a subject you are unclear about should satisfy the following requirements: it should be currently published, pertinent to the subject, provide accurate information from a reliable source, be reputable, contain supporting information in the form of diagrams, graphs, charts, or illustrations, and take the audience they are addressing into account.

To know more about error here

https://brainly.com/question/12515229

#SPJ4

prepare a chart on the different kingdoms of the sangam age

Answers

Sangam Age is the period from the 3rd century BC to the 3rd century AD in south India. There were 3 Sangams conducted in ancient South India called Muchchangam. Three dynasties ruled during the Sangam Age – the Cheras, Cholas and Pandyas.

CHERAS:

The Cheras ruled over large parts of modern-day Kerala. Vanji was the capital of the Cheras. The emblem of Cheras is the ‘bow and arrow’. Senguttuvan (2nd century CE) was the prominent ruler of the Chera dynasty.  He was the first to send an ambassador to China from South India.

CHOLAS:

The Chola dynasty was one of the longest ruling dynasties in the history of the world. King Karikala was a prominent king of the Sangam Chola dynasty. The insignia/emblem of the Cholas was ‘tiger’.  Trade and commerce prospered during his rule.

PANDYAS:

The Pandyas reigned over the Southern region of modern-day Tamil Nadu. Madurai was the capital of Pandyas. Their emblem was the ‘Carp’. King Neduncheliyan was the ruler.

To know more about Sangam Age, refer to the below link:

https://brainly.com/question/24306212

Did Snowball betray the farm?

Answers

Answer: Yes

Explanation: Napoleon justifies his takeover by telling the other animals that Snowball was a traitor secretly working for the human farmers.

What the rights needed by each individual to pursue their lives and goals without interference from other individuals or the government?

Answers

The freedom to live one's life and pursue their goals without hindrance from the government or other people is known as an individual's right. Individual rights commonly take the form of the rights to life, liberty, and the pursuit of happiness.

What are an individual's rights in the community?

The freedoms of speech, religion, the right to keep and bear arms, the right to assemble, and the right to petition are all protected by the Bill of Rights. Additionally, it forbids compelled self-incrimination, harsh and unusual punishment, and arbitrary search and seizure.

Freedom of expression, freedom of religion, the right to privacy, and the right to possess property are a few examples of individual rights. Individual liberties are frequently linked to democracy, a form of governance in which the people hold the reins of power.

To know more about individual's right visit:

https://brainly.com/question/619133

#SPJ4

toni presents with depressive symptoms that have not remitted for the last two years. their symptoms are mildly disabling, and they are still able to handle a few aspects of their life. their likely diagnosis is:

Answers

Their likely diagnosis is persistent depressive disorder with dysthymic syndrome.

What means dysthymic disorder?A less severe but persistent form of depression is called dysthymia. Persistent depressive disorder is another name for it. Major depressive episodes are occasionally experienced by those who have this illness. A mood illness called depression affects your body, emotions, and thinking.The causes of dysthymia, like those of major depression, include genetic predisposition, neurochemical imbalances, childhood and adult stress and trauma, as well as social factors, including isolation and the lack of access to aid.Dysthymia is a serious condition, yet it can also easily managed. As with any chronic condition, early detection and medical intervention may lessen the severity and length of symptoms as well as the chance of experiencing a major depressive episode.

To learn more about dysthymic syndrome  refer,

https://brainly.com/question/15170797

#SPJ4

What are 3 major events of the Protestant Reformation?

Answers

Luther takes the pope to task in 1517, Reformist zeal sweeps the south in 1519 and Rome flexes its muscles in 1520 are 3 major events of the Protestant Reformation.

A 16th-century religious movement that started as an effort to reform the Roman Catholic Church and led to the establishment of Protestant churches. When Henry VIII was king of England, his desire to have his marriage declared null and void resulted in a dispute with the pope, which caused England to secede from the Roman Catholic Church and adopt Protestantism. Martin Luther left the Church, sparked the Protestant Reformation, and gave rise to numerous new Christian faiths. The main outcome of reformation was the emergence of new Christian denominations.

To learn more about the protestant reformation, click at:

https://brainly.com/question/2973841

#SPJ4

Why is Article 1 Section 3 important?

Answers

The Senate is established in Article I, section three. The Constitution stipulated that senators would be chosen in two-year increments every six years, which is still the custom today.

Give a brief account on Senate.

Election Day is the first Tuesday after the first Monday in November in even-numbered years, when the Senate and House of Representatives elections are held simultaneously. All of the people in a state elect senators. The United States Constitution gives each state the authority to enact laws governing how senators are elected. State-to-state variations exist in the laws governing independent and minor party candidates' access to the ballot. The Republican and Democratic parties hold primary elections first in 45 states, and then a few months later, the general election. Most of these states allow the nominee to win with just a plurality, while others require a runoff if a majority cannot be won. The candidate who wins a majority of the popular vote is declared the winner of the general election.

To know more about, Senate, visit :

https://brainly.com/question/24779287

#SPJ4

The un agency broadly responsible for refugees is?

Answers

The UN agency which is broadly responsible for the refugees is called as the UNHCR.

The United Nations High Commissioner for Refugees (UNHCR), the UN agency is for the refugees, is an international organisation working to saving lives, safeguarding the rights and also simultaneously providing a better future for the refugees, also by forcibly displaced communities and also the stateless people.

However, the UNHCR emerged in the wake of the World War II in order to help Europeans displaced by that conflict. The UNHCR was established on December 14, 1950 by UN General Assembly.

Hence, the UNHCR protects the refugees worldwide.

To leran more about the UNHCR here:

https://brainly.com/question/14457080

#SPJ4

Duty to Have Fall Protection
Fall protection is generally required when one or more employees have exposure to falls of six feet or greater to the lower level.

Surfaces must be inspected before the work begins.

Employees are only permitted to be on surfaces that are strong enough to support them.

Answers

When walking or working on surfaces with unprotected edges or sides that are six feet or more above a lower level, employers are required to implement fall protection equipment to safeguard their employees.

Guardrails, safety nets, and individual fall arrest systems are all examples of fall protection. Fall protection is required by OSHA in general industrial workplaces at altitudes of four feet, in shipyards at elevations of five feet, in the construction sector at elevations of six feet, and eight feet during longshoring activities. When one or more employees are at risk of falls of six feet or more to a lower level, fall protection is typically necessary. Before work begins, surfaces must be assessed.. Employees are only permitted to be on surfaces that are strong enough to support .In general, employees systems, safety net systems, or personal fall arrest devices can be used to provide fall protection. OSHA refers to these tools as traditional fall protection. Safety gear that is used to make working at heights safer includes fall protection. Typically, the phrase relates to The phrase, when used specifically, refers to all steps and tools taken to avoid falls.

Learn more about Fall protection here:

brainly.com/question/29566451

#SPJ4

which of the following best describes the message in the political cartoon? contributions from special interests have undermined fair and competitive political campaigns. placing limits on special interest contributions would not diminish the role of money in elections. although money garners attention from the media and voters, it does not influence how people vote. special interests have a large amount of cash but a small number of votes to use to influence elections.

Answers

The message in the political cartoon is contributions from special interests have undermined fair and competitive political campaigns.

Several elements give an explanation for political participation. They consist of socioeconomic status, degrees of civic engagement, formal obstacles, and efforts through political establishments to mobilize people. Political cartoons (additionally called editorial cartoons) are described as illustrations or comedian strips containing a political or social message that generally pertains to modern occasions or personalities. political cartoon, a drawing (frequently consisting of caricature) made for the reason of conveying editorial observation on politics, politicians, and modern occasions.

Thus, contributions from special interests have undermined fair and competitive political campaigns is the bets message.

To learn more about political participation check the link below:

https://brainly.com/question/1323955

#SPJ4

Recruiting into research ...
Is entirely at the investigator's discretion.
Always requires a written authorization for ANY contact with the patient.
Never requires a written authorization.
Can qualify as an activity "preparatory to research," at least for the initial contact, but data should not leave the covered entity.

Answers

Recruiting into research can qualify as an activity "preparatory to research," at least for the initial contact, but data should not leave the covered entity. Hence, option (c) will be regarded as the relevant option choice.

What is a research ?

"Creative and methodical activity undertaken to improve the reservoir of knowledge" is how research is defined. It entails gathering, organizing, and analyzing data in order to better understand a subject, and is distinguished by a specific focus on identifying and eliminating sources of bias and inaccuracy. Accounting and bias control are features of these operations. The results of earlier fieldwork may be developed into a research project. To verify the accuracy of tools, procedures, or experiments, research may replicate complete projects or portions of past studies.

As opposed to applied research, fundamental research's main goals are the progress of human knowledge through documentation, discovery, interpretation, and research and development (R&D) of methods and systems. Epistemologies, which differ greatly both within and between the humanities and sciences, are what guide research methods. There are many different types of research, including those in the humanities, arts, economy, social issues, business, marketing, practitioner research, life, and technology. Meta-research is the term for the academic study of research methodologies.

To know more about, research, visit :

https://brainly.com/question/18723483

#SPJ1

What is the main idea of slavery?

Answers

The act of possessing someone; also referred to as slavery. Since a slave was viewed by the law as property, or property, they were denied the majority of rights that free people generally enjoy.

What essential concept drives To Slavery to Freedom?

African Americans' struggle for freedom in America from enslavement in the 18th and 19th century through the civil rights movements in the 20th and 21st century is examined in the book From Slavery to Freedom.

What was the primary justification for slavery in those days?

Slaves in West Africa rose in value as demand for inexpensive labor to work in plantations there in Americas increased among European traders.

To know more about slavery visit :

https://brainly.com/question/9030828

#SPJ4

What was the effect of the Schenck case?

Answers

The clear and present danger test was outlined by Justice Oliver Wendell Holmes Jr. in the ruling, which established that Congress has more latitude than in peacetime to restrict speech.

How did the Schenck v. US case affect things?

The famous "clear and present danger" test was created by the Supreme Court in Schenck v. United States (1919) to determine when a state could constitutionally restrict an individual's First Amendment-protected right to free speech.

What is the Schenck case and its importance?

United States, a legal case in which the Supreme Court of the United States decided on March 3, 1919, that the First Amendment's protection of free speech could be limited if the words spoken or printed represented a "clear and present danger" to society.

To learn more about First Amendment here:

https://brainly.com/question/1078243

#SPJ4

Most young people report that ____ are their principal source of information on sexual topics.

Answers

Most young people report that friends are their principal source of information on sexual topics.

It has been reported that the friends tend to emerge as the major source of communication and with information on most topics including sexual intercourse, birth control, and dating norms and also expectations.

Hoiwever, sex education may be thus provided by parents or caregivers or as part at school programs and as well as the public health campaigns. In some countries it is known as the relationships and sexual health education.

Hence, the most frequently reported sources were said to be teachers, friends, mothers, and also media.

To learn more about sex education here:

https://brainly.com/question/29244723

#SPJ4

Are symbols noted on the title sheet?

Answers

The title or introduction sheet must include a note about the symbols. Keynotes never take the place of symbols.

Why is it vital to understand the floor plan symbols?

A floor plan offers a distinct and in-depth perspective of a structure or piece of land to give the prospective buyer and the construction team an idea of the construction and design specifics. Each building component in a floor plan is represented by a floor plan symbol. Firstly, symbols in architectural designs show what needs to be built and placed as well as where. A drawing's title block is made up of the information boxes that are located in the bottom right corner and that list the drawing's title, author, scale, and creation date.

To know more about symbol visit:

brainly.com/question/17698998

#SPJ4

Is Gulliver Travels a real story?

Answers

Gulliver's Travels, a satirical classic, was penned in 1726 by an Irish author and clergyman. "Gulliver's Travels," a fantasy novel by Jonathan Swift, has numerous entirely fictional facts.

What is Gulliver Travels?

A satirical classic, Gulliver's Travels is a 1726 book written by an Irish author and clergyman.

Jonathan Swift's fantasy book "Gulliver's Travels" has a lot of wholly made-up details.

In the narrative, the Lilliputian people live on the imaginary island of Lilliput.

The fictional Lemuel Gulliver serves as both the protagonist and the narrator of Jonathan Swift's 1726 book Gulliver's Travels.

By Lemuel Gulliver is a prose satire written in 1726 by the Anglo-Irish author and priest Jonathan Swift that parodies both human nature and the literary genre of "travelers' tales."

Therefore, Gulliver's Travels, a satirical classic, was penned in 1726 by an Irish author and clergyman. "Gulliver's Travels," a fantasy novel by Jonathan Swift, has numerous entirely fictional facts.

Know more about Gulliver Travels here:

https://brainly.com/question/1228550

#SPJ4

Mastering A&P Chapter 12 - The Central Nervous System

Answers

The portion of the nervous system that is made up mostly of the brain and spinal cord is known as the central nervous system (CNS).

The central nervous system (CNS) is so named because the brain integrates the information that has been received and coordinates and regulates the activity of all body parts of bilaterally symmetric and triploblastic animals—all multicellular organisms aside from sponges and diploblasts. It is a structure made of neural tissue that runs from the rostral end of the body (the nose end) to the caudal end (the tail end). It may have an expanded portion at the rostral end that is the brain. A genuine brain can only be found in vertebrates, arthropods, and cephalopods (precursor structures exist in onychophorans, gastropods and lancelets).

Learn more about central nervous system here

https://brainly.com/question/29775561

#SPJ4

What are the 2 aims of Baroque art?

Answers

This style, sometimes known as baroque, tries to create ethereality and wonder through an extravagant aesthetic. The Baroque era is still regarded as one of the most significant cultural eras in the development of Western art.

What was the Baroque era?

Early in the 17th century, in Italy, a highly dramatic and ornamental architectural style known as baroque emerged. It later expanded throughout Europe. The Late Baroque era (1675–1750) saw its influence extend as far as Russia and the Spanish and Portuguese possessions in Latin America. In Central Europe, a style known as Rococo that was considerably more ornately decorated than the previous one emerged around 1730. The basic components of Renaissance architecture, such as domes and colonnades, were taken by baroque architects and enhanced with higher, grander, more ornate, and dramatic designs. The interior effects were frequently created using quadratura, or trompe-l'oeil painting coupled with sculpture; the eye is attracted upward, giving the impression that one is staring into the skies. The ceiling is covered in swarms of painted and sculptured figures.

To learn more about Baroque era, visit:

https://brainly.com/question/28900823

#SPJ4

News Debate: Snowed Out!

Answers

Answer:

Explanation:

what are students at mississinawa valley school saying “so long” to

T/F an expert system is not a good choice when a lot of human expertise is needed to tackle a problem.

Answers

False, an expert system is certainly not a decent decision when a ton of human skill is expected to handle an issue.

Expert systems don't have human abilities. They utilize an information base of a specific space and present that information as a powerful influence for current realities of the specific circumstance within reach. The information base of an ES likewise contains heuristic information - general guidelines utilized by human specialists who work in the space.

A specialist framework is a PC program that utilizes man-made brainpower (man-made intelligence) advancements to recreate the judgment and conduct of a human or an association that has skill and involvement with a specific field. Master frameworks are typically planned to supplement, not supplant, human specialists.

Learn more about human expertise:

https://brainly.com/question/14413059

#SPJ4

What is westernization in India?

Answers

Westernization in India is the process of Indian society adopting Western culture, customs, values, beliefs, and lifestyles.

The Impact of Westernization on Indian Society

Westernization in India is the process of Indian society adopting Western culture, customs, values, beliefs, and lifestyles.

This includes the adoption of western fashion, technology, food, language, music, media, and other aspects of Western culture. Westernization has been taking place in India for centuries, and has been increasing in recent years due to increased globalization.

Learn more about Westernization in India at: https://brainly.com/question/13066349

#SPJ4

According to the energy conservation theory of sleep, sleep is an adaptive behavior because sleep __________.

Answers

According to the energy conservation proposition of sleep, sleep is an adaptive geste

because sleep Allows organisms to consume smaller coffers.

To know more about conservation theory of sleep visit https://brainly.com/question/2274133

According to the energy conservation theory of sleep, sleep is an adaptive behavior because sleep allows organisms to consume fewer resources.

According to the energy conservation theory, the major purpose of sleep is to lower a person's energy requirements during the hours of the day and night when hunting for food is least effective. The body's natural tendency to lower its metabolism by as much as 10% during sleeping lends credence to this hypothesis.

Its basic thesis—that restoration can only take place during rest periods—has significant ramifications for biological and medical systems. Often referred to as the Father of Sleep Medicine, Dr. William C. Dement (1927) originally published Oswald's Restoration Theory in the 1920s.

To know more about conservation theory of sleep visit

brainly.com/question/2274133

#SPJ4

Which of the following is not an example of directory information that can be disclosed without consent?

Answers

The following is not an example of directory information that can be disclosed without consent: student's grade.

Directory information is information contained in a student's education record that may be disclosed to third parties without the student's prior written consent. Students' names, addresses, phone numbers, email addresses, dates and places of birth, honors and awards, and dates of attendance are all listed in the directory. It also contains a slew of other school-related information. Schools must, however, inform parents and eligible students about directory information and give them a reasonable amount of time to request that the school not disclose directory information concerning them. Students or parents must request in writing that their directory information not be disclosed with third parties.

Learn more about student's information privacy https://brainly.com/question/28243713

#SPJ4

Other Questions
What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E.