At 8 a.m., the hobbit left Beorn's and headed towards the Misty Mountains at 3 mph. 2
hours later, Gandalf left Beorn's and headed in the same direction. If Gandalf was 5 miles
ahead at noon, what was his speed?

Answers

Answer 1

Answer:

8.5 mph

Step-by-step explanation:

First find how far Hobbit traveled in 4 hrs (8AM - Noon)

3 mph x 4 hr = 12 miles

Now find Gandalf's speed:

Galdalf traveled the same 12 miles that Hobbit did PLUS 5 more miles in 2 hours (10AM -Noon) for a total of 17 miles

Speed = 17 mi / 2 hr = 8.5 mph


Related Questions

find the area please​

Answers

Answer:

86.54625

Step-by-step explanation:

Formula: a = πr², r = d/2

Given: π = 3.14, d = 10.5

Sub: a = (3.14)r²

Find r.

10.5/2

5.25

Sub: a = (3.14)5.25²

Solve: 86.54625

What is the geometric mean of 6 and 8?

Answers

Answer:

16 square root 6

Step-by-step explanation:

The geometric mean of 6 and 8 is [tex]4\sqrt{3}[/tex]

What is geometric mean?

The geometric mean of two numbers [tex]x_1[/tex] and [tex]x_2[/tex] is given by the formula:

[tex]GM = \sqrt{x_1 \times \ x_2}[/tex]

The two given numbers are 6 and 8

That is, [tex]x_1=6[/tex] and [tex]x_2=8[/tex]

Substitute  [tex]x_1=6[/tex] and [tex]x_2=8[/tex] into the formula [tex]GM = \sqrt{x_1 \times \ x_2}[/tex]

[tex]GM=\sqrt{6 \times 8}[/tex]

Simplifying further:

[tex]GM=\sqrt{48} \\\\GM=4\sqrt{3}[/tex]

Therefore, the geometric mean of 6 and 8 is [tex]4\sqrt{3}[/tex]

Learn more on geometric mean here: https://brainly.com/question/1311687

what is the product
4/6 x 9

13/16

36/54

3

6​

Answers

the answer is 6! have a good day

10. Mason earns $10 for each lawn he mows. How much will he earn if he mows 6 lawns?
A. Write and solve an equation to solve the problem. Show your
work.

Answers

$10.00 x 6 =
$60.00
I’m not sure how to show any more work than that. It’s just 10 times 6..

Answer:

60

Step-by-step explanation:

just multiply 10 by 6 why is this in highschool math though.

A triangular pyramid is formed from three right triangles as shown below.
Use the information given in the figure to find the length BD.
If applicable, round your answer to the nearest whole number.
The lengths on the figure are not drawn accurately.

Answers

ΔADC is a right angle triangle, we will use the Pythagorus Theorem to find the length CD.

Formula of the Pythagorus Theorem :  

⇒ a² + b² = c²

⇒ AD² + CD² = AC²

The value of AD is 54 and the value of AC is 90:

54² + CD² = 90²

Solve for CD:

54² + CD² = 90²

CD² = 90² - 54²

CD² = 5184

CD = √5184

CD = 72

ΔADC is also a right angle triangle, we will use the Pythagorus Theorem to find the length BD.

Formula of the Pythagorus Theorem :  

⇒ a² + b² = c²

⇒ BD² + CD² = BC²

The value of CD is 72 and the value of BC is 97:

BD² + 72² = 97²

Solve for BD:

BD² = 97² - 72²

BD² = 4225

BD = √4225

BD = 65

Answer: The length of BD is 65 units.


A new savings account is opened with $400 and gains 3% every year. What is the value of the account at 32 years?

Answers

Answer:

1072

Step-by-step explanation:

additive inverse of 8/-13 pls help fast​

Answers

Answer:

8/13

hope this answer helps you.....

Please answer the question bellow

Answers

No solution

because delta ( b^2 - 4ac ) is lower than 0(zero) .

Which one doesn’t belong?
Come up with one reason for at least 3 different boxes

Answers

Answer:

I think box #1 doesnt't belong because it say spend $100 and get $10 off

Step-by-step explanation:

Can someone please help me with math.

Answers

Answer:

B

Step-by-step explanation:

The solution to a system of equation is when two lines pass and intersect ona specific point. Here we are looking for (0,1).

we can see b intersects on (0,1) so that is out answer.

What is the scale factor from Figure A to Figure B?

Answers

The scale factor equals 4. I just divided 72 and 18 and got that. You can do that with each side and you’d still get 4. :)

Someone pls help:( im new tysm if u doo!

Answers

75.5 all you do is add them
59 + 16.5= 75.5! I’m new too let me know if you need anymore help you can always message me! (I’m in seventh grade and I really like to help people!, it’s really entertaining for some reason)

A rectangular prism has a base with a length of 25, a width of 9, and a height of 12. A secod prism has a square base with a side of 15. If the volumd of the two prisms are equal, what is the height of the second prism?​

Answers

Answer:

6cm

Step-by-step explanation:

correct for 100 points i swear

A .Write an equation for the trend line in slope -intercept form .

Answers

Given:

The graph of a trend line.

To find:

The equation of the trend line is slope intercept form.

Solution:

From the given graph it is clear that the equation of the trend line is passes through the points (0,25) and (5,50).

Slope of the line is:

[tex]m=\dfrac{y_2-y_1}{x_2-x_1}[/tex]

[tex]m=\dfrac{50-25}{5-0}[/tex]

[tex]m=\dfrac{25}{5}[/tex]

[tex]m=5[/tex]

The line passes through the point (0,25). So, the y-intercept of the line is 25.

Slope intercept form of a line is:

[tex]y=mx+b[/tex]

Where, m is slope and b is y-intercept.

The slope intercept from of the line is:

[tex]y=(5)x+(25)[/tex]

[tex]y=5x+25[/tex]

Therefore, the equation for the trend line in slope -intercept form is [tex]y=5x+25[/tex].

Ashley deposited $4,000 into a savings account that earns 4% simple interest. How much interest did she earn after three years?

Answers

Answer:

for the 1st year she earned 160 so for 3 years she will earn $480

A zoo starts off with 8 monkeys, and the monkeys population
doubles every year. How many monkeys are in the zoo after 4
years?
monkeys

Answers

Answer:

32

Step-by-step explanation:

64 because the first year you’ll have 8 monkeys which doubles for the second year where you’ll have 16 monkeys. in the third year they will be 32 and it doubles in the last year making the total 64

James wants to cover a floor measuring 90 cm by 120 cm with square tiles of the same size.
Given that he uses only whole tiles, find the largest possible length of the side of each tile​

Answers

Answer:

30cm

Step-by-step explanation:

Find L.C.M of 90 and 120

Dwayne is having a birthday party with a total of 37 people (including himself). He needs to buy enough cases of soda to have 2 cans for each person. If a case of
soda contains 12 cans, how many cases will he need to buy?

Answers

Answer:

I do not know

Step-by-step explanation:

Find the value of x.

Answers

Answer: x =42°

The angles are equal

identify the equation whose graph is a vertical line.

a) y=x/3-1

b) y=0

c) x=0​

Answers

I’m guessing b I might be wrong

Please, nobody answered it!!! :C

Answers

Answer:

C. 59

Step-by-step explanation:

Hello There!

Remember the angles in a triangle add up to equal 180

So if we want to find a missing angle we subtract the given angles ( in this case 65 and 56) from 180

So missing angle = 180 - 65 - 56

180 - 65 = 115

115 - 56 = 59

So we can conclude that the missing angle has a measure of 59 degrees

Answer:

C: 59

Step-by-step explanation: His explanation is correct, I did it myself.

A quantity with an initial value of 980 decays exponentially at a rate of 0.3% every 6 decades. What is the value of the quantity after 49 decades, to the nearest
hundredth?

Answers

Answer:

956.73

Step-by-step explanation:

0.3% = 0.003

1-0.003 = 0.997

49/6 = 8 r1 (use 8 because decay is not continuous)

0.997^8 = 0.97625...

0.97625... x 980 ≈ 956.73

Answer: 956.25

Step-by-step explanation:

Please help! Check to see if I have all of them correct! Will mark brainlist

Answers

I am pretty sure they are all right

A grocery store is offering a sale on bread and soup. Khalil buys four cans of soup and three
loaves of bread for $11.67. Ronda buys eight cans of soup and one loaf of bread for $12.89.
Homework Help!
a. Write equations for both Khalil's and Ronda's purchases.
b. Solve the system to find the price of one can of soup and the price of one loaf of bread.

Answers

Answer:

a) For Khalil's purchase

4x + 3y = 11.67.....Equation 1

For Ronda's purchase

8x + y = 12.89......Equation 2

b) A can of soup = x = $2.09

Loaf of bread = y = $1.35

Step-by-step explanation:

A grocery store is offering a sale on bread and soup. Khalil buys four cans of soup and three

loaves of bread for $11.67. Ronda buys eight cans of soup and one loaf of bread for $12.89.

Homework Help!

Let us represent:

a can of soup = x

Loaf of bread = y

a. Write equations for both Khalil's and Ronda's purchases.

For Khalil's purchase

= Khalil buys four cans of soup and three loaves of bread for $11.67.

4x + 3y = 11.67.....Equation 1

Ronda buys eight cans of soup and one loaf of bread for $12.89.

8x + y = 12.89......Equation 2

b. Solve the system to find the price of one can of soup and the price of one loaf of bread.

We have:

4x + 3y = 11.67.....Equation 1

8x + y = 12.89......Equation 2

y = 12.89 - 8x

We substitute 12.89 - 8x for y in Equation 1

4x + 3(12.89 - 8x) = 11.67

4x + 38.67 - 24x = 11.67

38.67 - 11.67 = 24x - 4x

27 = 20x

x = 27/20

x = 1.35

y = 12.89 - 8x

y = 12.89 - 8 × 1.35

y = 12.89 - 10.8

y = 2.09

Therefore,

Solving for y

a can of soup = x = $2.09

Loaf of bread = y = $1.35

find the surface area of the pyramid​

Answers

Answer:

864cm squared

Step-by-step explanation:

The base is 16 x 16

The 4 lateral faces (Triangles) are [(19 x 16) / 2 ] x 4}

Anyone help me solve for y.

Answers

Answer:

y = - 4

Step-by-step explanation:

Given

y = 2x + ( - 2) , that is

y = 2x - 2 ← substitute x = - 1

y = 2(- 1) - 2 = - 2 - 2 = - 4

This is confirmed by the point (- 1, - 4 ) on the graph

X = -1
So if you Plug that in to your problem it is shown as y=2(-1)+-2.
2•-1 is -2 and when added to -2 you answer is -4.
Y=-4

I need help I'm struggling :(

Answers

Ohh !! I’ll help you. I think your suppose to find the area of the rectangle prism? I suppose?
To find the rectangular prism, you’ll have to use this formula : LWH
L= length
W=width
H=height
Multiply those together and you will get your answer.

V=LWH
V=6*6*10
V=36*10
V=360 square 2 is your answer! ( remember to put units )

- have a great day :)

What is 2 2/13 divided by 2/3

Answers

Answer:

3.23

Step-by-step explanation:

Answer:

the answer is 3.23 hahahhhhahahhahndjalid;jslakjsakl sorry needed that to submite the answer

Please help me out with this

Answers

Answer:

Step-by-step explanation:

surface area = 3^2 : 11^2

volume = 3^3 : 11^3

width  = 3: 11

hmm I'm not sure what you can enter into the text boxes.. if it won't let you put in the exponentials just use your calculator to put in the number that they equal.   But I like the exponential form better.  

42. Use the Quadratic Equation to find the Roots of x2 + 3x - 3=0

Answers

Answer:

Step-by-step explanation:

The coefficients of the x terms are {1, 3, -3}, so the discriminant, b^2 - 4ac, is 3^2 - 4(1)(-3), or 9 + 12, or 21.  The positive nature of the discriminant tells us that there are two real, unequal roots.  Following the quadratic formula, we get:

       -3 ± √21

x = -----------------

              2

Other Questions
Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Find the verbal in the sentence below. Then, Identify the type of verbal.Jane wanted to forget about the matter.-infinitive-participle-gerund Which choice is similar to the figure shown?Please help Im confused on what to do. A physics student of mass 43.0 kg is standing at the edge of the flat roof of a building, 12.0 m above the sidewalk. An unfriendly dog is running across the roof toward her. Next to her is a large wheel mounted on a horizontal axle at its center. The wheel, used to lift objects from the ground to the roof, has a light crank attached to it and a light rope wrapped around it; the free end of the rope hangs over the edge of the roof. The student radius 0.300 m and a moment of inertia of 9.60 kg m^2 for rotation about the axle, how long does it take her to reach the side walk, and how fast will she be moving just beofre she lands? a wave travels one complete cycle in20sec and has wavelength of 1000mm.what is the speed Solve for y:5y+2-2y=8y-4-2y Voluntary migration on culture PLEASE PLEASE HELP IVE BEEN STUCK ON THIS FOR TOO LONG help me please this gives 30 points Describe the steps a plant would take to move sugars from a source to a sink. Which of the following is a check on the power of the judicial branch? aThe president overturns a Supreme Court ruling. bThe House of Representatives impeaches a justice. cThe Senate nominates judges for the Supreme Court. dThe Congress rejects a ruling by the Supreme Court. This OS integrated the processing power of Windows NT with the easy-to-use GUI of Windows 98.Windows Millennium EditionWindows 2000Windows for WorkgroupsWindows 3.11 I was a member of a separatist church that fled first to the Netherlands and then to the New World in search of religious freedom. The men and I signed a document aboard our ship, the Mayflower, that outlined the basics of our self-government. I was governor of the Plymouth Colony until my death. I also wrote a book about the history of our colony. Who am I? Please help me I really need it