Match the characteristic

Movement

Reproduction Sensitivity

Growth

Respiration Excretion

Nutrition

1.Getting rid of
waste.
o
o
o
o
o
0
o
o
The ability to
produce
offspring to
keep the
species in
existence.
O
o
0
O
o
The process
increasing
hysical
O
o
o
o
o

Answers

Answer 1

Explanation:

Excretion - Getting rid of

waste

Reproduction- The ability to

produce

offspring to

keep the

species in

existence.

Growth- The process

increasing

hysical


Related Questions

what would happen to an organism if mitosis did not occur

Answers

If mitosis DID NOT happen... the organism would stay as a single cell. The life we know it now... wouldn't exist as we have multi-cellular stuff.

Imagine that the climate in your region became extremely arid, and freshwater became a scarce and precious resource. Wasteful uses of water, such as watering lawns and filling swimming pools, would be strictly outlawed, and water from the municipal water supply would cost 100 times what it does now. Discuss how you would adapt to that situation.

Answers

I would adapt to such situation by ensuring that physical activities are

reduced , use of water is adjusted and recycling is maximized.

Water is a n important component of life as we need water for various

activities such as drinking, cooking, washing etc. Scarcity of water can result

to unhygienic conditions and dehydration which could result in death.

it is best to ensure physical activities are reduced to prevent dehydration

through sweating. The wastage of water should be reduced to the barest

minimum through use adjustment and recycling.

Read more about adaptation on https://brainly.com/question/15118660

I want a sister I can’t live like this with my parents

Answers

[tex] \large \sf{ah ! \: now \: what \: you \: will \: do?} \\ \large \sf{what \: did \: you \: decide?}[/tex]

A white woman says she is not racist but avoids sitting near Black individuals. She has

A.high explicit racism, low implicit racism
B.high explicit racism, high implicit racism
C.low explicit racism, low implicit racism
D.low explicit racism, high implicit racis

Answers

I believe it is A
Please make this the brainliest answer

pls check help /edtrphzjbi​

Answers

Answer:

I don't get it but heres your answer

Explanation:

sharghvquvbOIQUugua

There you go!

how does urbanization cause air pollution​

Answers

.Answer:Concentrated energy use leads to greater air pollution with significant impact on human health. Automobile exhaust produces elevated lead levels in urban air. Large volumes of uncollected waste create multiple health hazards. Urban development can magnify the risk of environmental hazards such as flash flooding.

Explanation:

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

How can i earn money from this app?

Answers

Answer:

u dont earn money from brainly. the point is altruistic help

Explanation:

if u mean something else, provide context and ill leave a comment with the correct answer

What does saccharide mean?

lipid

base

acid

sugar

Answers

Saccharide is another term for sugar.

In which of the following ways can albert reduce the resources he consumes

Answers

Answer:

where is option man?

please,send option also

Which type of cloud is made up of both liquid water droplets and ice crystals?

Answers

Answer:

Altostratus clouds are gray or blue-gray mid-level clouds composed of ice crystals and water droplets. The clouds usually cover the entire sky.

Explanation:

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

Deana applies the data in the table to calculate the rate of population increase or decrease of each country. Which assumption is necessary for Deana’s calculations to be accurate?

Answers

It should be noted that population is simply used for the determination of the economic activity of an area or country.

Your information is incomplete. Therefore, an overview of population will be given. Population simply means the inhabitants of a particular place or the number of organisms living in an area.

The increase or decrease in the rate of population is calculated by the formula:

= (New population - Old population) / Old population × 100

Learn more about population on:

https://brainly.com/question/13403673

In the pregnancy time the embryonic cells are developed into different types of cells,tissues,organs How??​

Answers

Answer:

The embryonic stage plays an important role in the development of the brain. Approximately four weeks after conception, the neural tube forms. This tube will later develop into the central nervous system including the spinal cord and brain. The neural tube begins to form along with an area known as the neural plate.

Explanation:

Select all of the following that correctly describe the Streptococcus genus
- Gram Negative
- Gram Positive
- Cocci
- Bacilli
- Tetrads
- Sarcinae
- Strepto
- Staphylo
- Fastidious
- Can grow in salt
- Can grow in acid
- Normal flora of the skin

Please explain if possible!

Answers

Gram Positive :

Streptococcus is a genus of spheroidal bacteria that belongs to the Streptococcaceae family.

The bacteria's distinctive clustering in chains that resemble a string of beads is referred to as streptococcus ("twisted berry"). Microbiologically, streptococci are classified as gram-positive and nonmotile. Cocci :

Streptococcus is a genus of gram-positive coccus (plural cocci) or spherical bacteria belonging to the Streptococcaceae family, which is part of the Lactobacillales (lactic acid bacteria) order in the Firmicutes phylum.

Gram-positive cocci are a diverse collection of bacteria that have a similar shape. Sarcina cells, for example, are grouped in cubical pockets. Streptococcus spp. resemble a string of pearls. Staphylococcus species do not divide on a regular plane.Bacilli :

Streptococcus bacteria subdivide into Strep. pyogenes (Group A), Strep. agalactiae (Group B), enterococci (Group D), Strep viridans, and Strep pneumonia. Gram-positive bacilli (rods) subdivide according to their ability to produce spores.

If complete hemolysis of the blood cells is observed, the streptococci are classified as beta'hemolytic. M protein is considered the most important virulence component of S. pyogenes. Antibodies that react with M protein are produced in response to infection. A prospective antistreptococcus vaccination based on the M protein or a derivative of it is being studied.Tetrads :

The tetrad occurs in a subgroup of the cocci where the bacterium divides in two planes to form a square of four bacteria called a tetrad. Some examples of tetrad-forming bacteria are the lactic acid bacilli, Aerococcus, a urinary tract pathogen and Pediococcus and Tetragenococcus, both of which ferment foods.

Tetrads are groups of four cocci that are positioned in the same plane (e.g. Micrococcus sp.). Sarcina is a bacterial genus that consists of eight cocci arranged in a cuboidal pattern (e.g. Sarcina ventriculi).Sarcinae :

Sarcina is a Gram-positive cocci bacterium genus belonging to the Clostridiaceae family. After the cuboidal (2x2x2) cellular affiliations they create during division along three planes, the genus gets its name from the Latin word "sarcina," which means "pack or bundle."

Diplococci are pairs of cocci; streptococci are rows or chains of such cells; staphylococci are grapelike clusters of cells; sarcinae are packets of eight or more cells; and tetrads are groups of four cells in a square layout. Variations in the reproductive mechanism of bacteria result in these distinctive groups.Strepto :

a combining term that means "twisted" and is used to make composite words: streptococcus

Streptococcus- a spherical or oval bacteria of the genus Streptococcus that occurs in pairs or chains and is harmful for humans, causing scarlet fever, tonsillitis, and other diseases.Fastidious :

Streptococcus is a genus of gram-positive cocci that are organized in chains. These are fastidious bacteria that need blood or serum added to their culture medium. They are non-motile and do not produce spores. Most are facultative anaerobes, which means they can grow on enriched media.

Streptococcus pyogenes - it's a nutrient-concious bacteria that ferments glucose to make lactic acid and has stringent growth needs. This section explains the growth and maintenance of S. pyogenes to help in the research of this organism.Can Grow In Salt :

On the basis of their salt tolerance, the salt tolerance test is used to identify enterococcal group D Streptococcus. Several bacteria, notably viridians streptococci, have been classified based on their capacity to thrive in the presence of a varying quantity of sodium chloride (NaCl).

The non-beta hemolytic streptococci (viridans, and non-enterococcal group D) do not grow in 6.5% NaCl broth; but some of the beta-hemolytic strains may grow in the broth.Can Grow In Acid :

Some streptococci can create acids, grow in acidic surroundings (acidophilia), make acids at low pH levels (aciduric capability), and synthesis intracellular and external polysaccharides.

Dental caries is associated mainly with acid production at pH values below 5 by nongrowing bacteria in dental plaque. Oral streptococci cannot grow at pH above about 5, although they can lower the pH of suspensions or biofilms to values of 4 or lower.Normal Flora of The Skin:

Bacteria make up the vast bulk of typical flora. Skin and nasal membranes are typically infected with Staphylococcus epidermidis.

Staphylococcus epidermidis is a Gram-positive bacterium that belongs to the Staphylococcus genus, which has around 40 species. It is found in marine sponges and is part of the normal human flora, most usually the skin flora and less commonly the mucosal flora.

Sources: ( https://www.cdc.gov/ )

Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?

A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano

Ik the answer is not c
Can someone help me figure this out plz and thank you

Answers

Answer: D

Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.

Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.

What is rock cycle ?

Rocks are naturally occurred on non-living earth which are made by collection of  mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.

The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.

In a rock cycle, when the break down of these igneous rocks occur  small particles that are transported and deposited to form sedimentary rocks,  When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.

The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks

For more details regarding rock, visit

brainly.com/question/9243222

#SPJ2

How does the carbon stored in the bodies of living organisms move into rocks?(1 point)

Carbon dioxide released through respiration dissolves in certain rocks, like limestone.

Living organisms decay, releasing carbon into the soil, and soil is compacted into rocks.

Living organisms decay and become fossils fuels, which eventually become rocks.

Carbon dioxide dissolves in ocean water and is slowly absorbed by rocks in the ocean.

Answers

In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.

When animals die, their bodies degrade into the soil, encasing the carbon in layers that eventually transform into rock or minerals. hence option b is correct.

What is rock?

Stone including limestone and its minerals is created when sediment and shell layers are bonded together over time.

Gases like carbon dioxide are among the forms of carbon that are stored in the atmosphere. Animals that consume the plants can then absorb and store this carbon.

When animals die, their bodies degrade into silt, encasing the carbon in layers that eventually transform into rock or minerals. Some of this silt may eventually turn into fossil fuels like coal, oil, or natural gas, which when burned, release carbon back into the atmosphere.

Therefore, when an animal dies to decompose into the soil which becomes rocks through carbon from living organisms moves into rocks, hence option b is correct.

Learn more about rocks, here:

https://brainly.com/question/23464190

#SPJ2

Abagnale's life could best be paraphrased as...​

Answers

Answer:

running from the law and later working for  the law.

Explanation:

Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.

I need help solving this for my homework please and thank you

Answers

Answer: chromosomal replication

Explanation:

I hate my biology teacher but he’s such a D.a.d.d.y

Answers

Answer: Dam

Explanation: Dammmmmmmmm

Determine if these statements are true or false: Introns represent a genome scrap
yard that provides DNA segments for genome evolution and a variety of small RNA
molecules
the RNA polymerase transcribes the DNA template it does so by
creating Okazaki fragments in one direction and a continuous strand on the
opposite direction
FALSE; FALSE
TRUE; FALSE
TRUE; TRUE
FALSE; TRUE

Answers

i think the answer would be: #2 - true; false

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Explanation:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Answer: consumers

Explanation: I took the test on edg

Which of these could be a consequence of a mutation in one of an organism's
sex cells?
O A. The loss of the organism's ability to reproduce
B. The disruption of protein synthesis in the organism
O C. The transfer of the mutation to one of the organism's offspring
D. The ultimate death of the organism

Answers

Answer:

c

Explanation:

When an egg and a sperm cell unite, the resulting fertilized egg cell receives DNA from both parents.

Ba
Regarding cell walls, which of
these is the MOST accurate?
im
A. Cell walls and cell membranes are the very
same thing
B. Cell walls burst any time the cell takes in too
much water.
C. Cell walls keep a plant, bacteria or fungus cell
from bursting when too much water is absorbed

Answers

Answer:

C

Explanation:

cell wall

When water moves into a plant cell, the vacuole gets bigger, pushing the cell membrane against the cell wall. The force of this increases the turgor pressure within the cell making it firm or turgid . The pressure created by the cell wall stops too much water entering and prevents cell lysis.

This part of a plant cell makes the process of photosynthesis possible.
Chloroplast
O Mitochondria
O Centrioles

Answers

The chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Photosynthesis refers to the metabolic reactions by which plant cells synthesize simple carbohydrates (glucose) by using the light energy from the sun and carbon dioxide.

Photosynthetic reactions can be divided into light-dependent reactions and light-independent reactions.

During photosynthesis, light-dependent reactions occur in the thylakoid membranes of chloroplasts.

In conclusion, the chloroplast is the organelle of a plant cell that makes the process of photosynthesis possible.

Learn more about chloroplasts here:

https://brainly.com/question/2512051

PLEASE HELP WITH THIS ONE QUESTION

Answers

Answer:

Fourth option

Explanation:

ATP - Adenosine Triphosphate (3Ps), ADP - Adenosine Diphosphate (2Ps). ATP breaks down into ADP because it loses a Phosphate Anion in whatever process that the ATP is becoming ADP.

In the image provided, fourth image shows how ATP breaks down into ADP. Option D is the correct answer.

ATP (adenosine triphosphate) is a molecule that stores and provides energy for cellular processes. When ATP is used, it undergoes a process called hydrolysis, where a water molecule is used to break a high-energy phosphate bond in ATP. Option D is the correct answer.

During this hydrolysis process, one of the phosphate groups in ATP is cleaved off, resulting in the formation of ADP (adenosine diphosphate) and an inorganic phosphate (Pi). The energy stored in the phosphate bond is released, making it available for cellular functions. The breakdown of ATP into ADP allows the released energy to be utilized by cells for various activities, such as muscle contraction, active transport, and synthesis of molecules.

Learn more about Adenosine Triphosphate here:

https://brainly.com/question/897553

#SPJ2

Need help right now can’t figure it out

Answers

Answer:

[tex]\huge\boxed{Alkane.}[/tex]

Explanation:

The given compound is an alkane because all the bonds between carbon are single. Alkanes have all single bonds and are thus called saturated hydrocarbons.

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Answer: Isaac

Explanation:

Other Questions
The areaof this figureis square inches.20 in28 in30 in.7 in25 in. In the past month Melissa went to buy video games and 7 DVD the rental price for each video game was $3.10 the rental price for each DVD was $3.70 what is the total amount that Melissa bent on the video game and the DVD rentals in the past month Which is the last step when creating and analyzing a scatterplot from a table of values?Plot the ordered pairs of the independent variable and the dependent variable on the coordinate plane.Draw or obtain a blank coordinate plane.Identify if there is a relationship between the independent and dependent variables.Label the axes of the coordinate plane according to the input and output variables. Find the expected value of the winnings from a game that has the following payout probability distribution: Skip Payout ($) 1 2 5 8 10 Probability 0.35 0.2 0.1 0.2 0.15 Expected Value = [?] Round to the nearest hundredth. What is bureaucracy? Should one of the High Contracting Parties be attacked by another Power, the otherHigh Contracting Party binds itself hereby, not only not to support the aggressoragainst its high Ally, but to observe at least a benevolent neutral attitude towards itsfellow Contracting Party.What MAIN cause does the above passage describe?A) MilitarismB) AlliancesC) ImperialismD) Nationalism can someone save my grade and clutch im so behind rn yall in baseball the home plate is shaped like the one shown it has three right angles and two other congruent angles A and B find measurement of angle a and measurement of angle B Who was the first African American to be a lawyer in Florida? Billions of dollars are spent on advertisements and marketing about the human body. From fashion and beauty products to weight loss reality shows, technology is the platform to which a person receives these different messages. Advertisers reach their target audience through different forms of technology such as smart phones, tablets, computers, and television. In the end, it can cause a person to think these advertised services and products are needed. The Connection between Body Image and Managing Weight Which statement best summarizes the central idea of the passage?A. Consumers spend too much money on health and beauty products in hopes of attaining their ideal body image.B. Weight loss is dependent upon the technology a person uses and the advertisements they view.C. Creating advertisements for distribution on various media outlets is costly.B. A person can develop a negative body image as a result of viewing too many advertisements. Why do immigrants face racism 3. Which of the following is a rationalnumber that is not an integer?A-2C 0B -0.5D 4 Reread the following quotation from paragraph 75: "oh god! to hear the insect on the leaf pronouncing on the too much life among his hungry brothers in the dust!" which of the following best states what this quote reveals about the ghost of christmas present's and scrooge's differing points of view?. ??.Who is the founder of Apple??.don't use gugle and Alexa Solve for HL hypotenuse leg theorem-GEOMETRY F(x) = 3x2+ 6x - 18 find f (10) which type of fragrance language is being used in the example we had to tip toe around the house so we didn't wake up sleeping beauty State whether the system is consistent or inconsistent. If it is consistent, then state whether the graphs' equations are dependent or independent. State the number of solutions. Who were the Boston Associates?Businessmen who recruited factory workersSlave tradersAnti-slavery publishersPoliticians Molly has biweekly gross earnings of $839. 52. By claiming 1 more withholding allowance, Molly would have $16 more in her take home pay. How many withholding allowances does Molly currently claim? a. 1 b. 2 c. 3 d. 4.