Dr. Berry, who employs the ecological approach to human development, is studying the relationship between the quality of parent-child interactions in the home and the success of children in school. Dr. Berry is studying development at the _________ level of environmental influence.
A) microsystem
B) mesosystem
C) exosystem
D) macrosystem

Answers

Answer 1

Dr. Berry was studying development in context of the mesosystem level of environmental influence.

What environment means?the totality of one's surroundings, situations, or influences; milieu. The environment that an organism is in at any particular time, including the air, water, minerals, creatures, and all other external variables.

Who should protect the environment?

As per the Article 51-A (g) of the Indian Constitution, "It shall be the duty of every citizen of India to protect and improve the natural environment, including forests, lakes, rivers, and wildlife and to have compassion for living... ", environmental protection has been made a fundamental responsibility of every citizen of India.

To know more about environmental visit

brainly.com/question/516941

#SPJ4


Related Questions

extrusive rocks have larger grains than intrusive rocks.true or false and why

Answers

False because extrusive rocks have fine-grained texture due to the rapid cooling of magna above the earth surface. On the other hand extrusive rocks have course grained texture due to slow cooling of magna beneath the Earth's surface

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

In the digestive system, what part of the body precedes the large intestine?
O A. Esophagus
OB. Stomach
O C. Small intestine
O D. Mouth

Answers

In the digestive system, small intestine of the body precedes the large intestine. Therefore, option (C) is correct.

What is small intestine?

The small intestine is a long, narrow tube-like organ that is part of the digestive system in humans and other animals. It is located in the abdominal cavity between the stomach and the large intestine, and is approximately 6 meters (20 feet) long in adult humans.

The primary function of the small intestine is to digest and absorb nutrients from food. It accomplishes this through the action of enzymes and other digestive secretions produced by the pancreas and liver, as well as through the action of tiny finger-like projections called villi and microvilli that line the intestinal walls. These structures increase the surface area of the small intestine, allowing for efficient absorption of nutrients into the bloodstream.

The small intestine plays a critical role in maintaining overall health and well-being by ensuring that the body receives the necessary nutrients to support its various functions.

Learn more about small intestine, here:

https://brainly.com/question/1751875

#SPJ7

in developing countries, which of the following is predicted to happen to both population and demand for meat and milk?

A. it will double by 2050
B. it will decrease by 2050
C. it will stay the same in 2050
D. it will increase slightly by 2050​

Answers

number c is the answer

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

answer and show proof for brainliest

Answers

Answer:

C- South America. Because South America is mostly rain forest and forests in the northern and mid section of it.

Explanation:

Which of the following fresh water biomes consists of moving water

Answers

Answer:

Biomes consists of moving water is estuaries.

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

What are examples of convections currents? What are examples of convection currents? A: the movement of war air into cooler air and cooler air into warmer air B: the movement of cool water into warmer water and warmer water into cool water. C: the displacement of air/water molecules by other air/water molecules due to varying temperatures. D: all of the above

Answers

Answer:

C: the displacement of air/water molecules by other air/water molecules due to varying temperatures

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

In pea plants, purple flowers (P) are dominant over white flowers (P). If two heterozygous purple flowered plants are
crossed with each other, then what are the possible genotypes of the offspring?
0
Answer is pp only

Answers

Answer :the answer is D

Explanation:

Which is not a part of the digestive system?

A. Large Intestine

B. Small Intestine

C. Trachea

D. Esophagus

Answers

The correct answer is c trachea

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

helpppp I’ll do anything BUT I HATE links so please NO links

Answers

Mitochondria: supplies energy to the cell

Nucleus: Control center of the cell; contains DNA

Ribosomes: makes proteins inside cell

Cell membrane: protective layer of the cell

Hope this helps :)

Mitochondria: source of energy to cell

Nucleus: contains dna and controls center

Ribosomes: produces protein

Cell membrane: gives protection

As a discussed in the lesson, eukaryotic cels are differ from prokaryotic cells based on what three things?

Answers

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

Both Mrs. Smith and Mrs. Jones had babies the same day in the same hospital. Mrs. Smith took home a baby girl named Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect, however, that her baby had been accidently been switched with the Smith baby in the nursery. Blood tests were made. Mr. Smith was blood type A, Mrs. Smith was type B, Mr. Jones was type A, Mrs. Jones was type A. Shirley was type O, and Jane was type B. Had a mix-up occurred? SHOW WORK!

Answers

Answer:

yes a mixup had occured because two A blood types would result in a baby with the same blood unle mr.jones wasnt the father

Explanation:

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

What is the formula to find out the energy when given the energy?

Answers

2
KE=0.5×m×v
2
I think

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

which role do plants play in the nitrogen cycle?

Answers

Answer:

C .they take up the usable forms of nitrogen found in the soil .

Explanation:

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

Other Questions
I really need help with this. Can you help me please? Which British foreign policy regarding Germany does this cartoon suggest?A. Imperialism B. Containment C. Appeasement D. nationalism YOU WILL BE MARKED BRAINLIEST:) An angle turns through 2/6 of a circle. What is the measure of the angle? 18) How do the first and second parts of this page differ?A)The first part lists sequential details; the secondpromotes the highlights of the park.B)The first part promotes the features of the parks, thesecond part lists factual information.The first part contains chronological informationabout the park, the second describes various features.D)The first part contains information that is organizedand easy to find information; the second is narrative. A box of 15 cookies cost nine dollars what is the cost for one cookie The First Tuesday1. As a dying man, Morrie still reads the news. What are your thoughts on this? Do you find it necessaryor a waste? Explain. What does it mean to brainstorm ideas for an informative essay? to think about issues, people, or events that could be topics to make a list of online sources to use to conduct research to outline the topic of the essay to provide a clear structure to analyze a primary source to gather information Freddy pays $840 per year ininsurance.How much should he budgetmonthly for it?A) $70B) $92C) $140D) $142 which graph represents the function f(x)=4|x|? Please guys help me *** 100 POINTS ***Define and explain the relationship between the following: hubris, nemesis, ate, arete. Distribute and combine like terms: 8(1 + 6 p) Choose the equation below that matches the word sentence: "3 increasedby x is 9."A.3x = 9B.3/x = 9C.3 + x = 9D.3 - x= 9 write a story that end with the phrase i will never do that again Jot Your InsightsDirections: Fill the blanks to complete the sentences. Copy and write your answersin your activity notebook.After doing all the activities in this module, I learned that parenthood is thstate of being a (1.)______It means being a mother and a father of thebiological child and when adoption is involved, the parents are the (2.).______father and mother of the child.I understand that responsible parenthood is (3.)_______I believe that responsible parenting is (4.)_______I realized that I need to improve my (5)______ What electromagnetic wave travels the fastest? Where would you find dietary restrictions for followers of Islam? Mai wants to buy a pair of jeans at the mall. The jeans cost $35.00. She has a coupon for that store. She pays $28.00 for the jeans. What was the percent of her discount? What are the three components of an essay prompt?a. position, counterargument and questionb. quote, position and questionc. counterargument, question, directiond. quote, question, directionsPlease select the best answer from the choices provided find the length of the third side of triangle if its midline measures 45cm