el espanol para nosotros nivel 1 pagina 148 actividad A

Answers

Answer 1

Answer:

hmmhmm

Explanation:hmm

Answer 2
I think u forgot to post a picture of the activity

Related Questions

Responda la pregunta con base en el texto dado.

Mundo familiar y mundo científico (Fragmento)

Como ser social me encuentro ligado a una historia. La parte sensible de mi conciencia me narra una historia de un mundo que me rodea. Esta historia habla de objetos familiares. Habla de los colores, de los sonidos, de los olores que le son propios; del espacio ilimitado en que están sumergidos y del tiempo que, en su curso incesante, produce cambios e incidentes. Me habla de una vida distinta de la mía, la cual sólo se ocupa de sus propios asuntos.



Como científico, he aprendido a desconfiar de esa historia. En muchos casos ha resultado que las cosas no son lo que parecen ser. Si creo lo que el narrador me dice sobre las cosas, en este momento tengo ante mí una mesa sólida; pero la física me ha enseñado que esta mesa no es exactamente la sustancia continua que la historia supone, sino una multitud de pequeñas cargas eléctricas lanzadas en todos sentidos con una velocidad inimaginable. En lugar de ser una sustancia sólida, mi mesa se ´parece más bien a un enjambre de mosquitos.

Arthur Eddington

Tomado de: Herrera Restrepo, Daniel. (1995). Teoría social de la ciencia y la tecnología. Santafé de Bogotá: Unisur. P.21.

A partir del contenido del texto podemos concluir que:

Answers

Answer the question based on the text given.

Family world and scientific world (Fragment)

As a social being I find myself linked to a story. The sensitive part of my conscience tells me a story of a world that surrounds me. This story talks about familiar objects. He talks about the colors, the sounds, the smells that are his own; of the unlimited space in which they are submerged and of the time that, in its incessant course, produces changes and incidents. He tells me about a life other than mine, which only takes care of its own affairs.

As a scientist, I have learned to distrust that story. In many cases it has turned out that things are not what they appear to be. If I believe what the narrator tells me about things, at this moment I have a solid table before me; but physics has taught me that this table is not exactly the continuous substance that history supposes, but a multitude of small electric charges thrown in all directions with an unimaginable speed. Rather than being a solid substance, my table looks more like a swarm of mosquitoes.

Arthur Eddington

Taken from: Herrera Restrepo, Daniel. (nineteen ninety five). Social theory of science and technology. Santafé de Bogotá: Unisur. P.21.

From the content of the text we can conclude that:

Is this what you need?

¿Esto es lo que necesitas?

I hoped this helped

Esperaba que esto ayudara

What word commplaetes the sentence 10 points Nosotros bebemos el café. Nosotros _______ bebemos. direct object pronoun: lo, la, los or las.

Answers

Answer:

los

Explanation:

its masculine and its plural

1.
un collar/ al su hijo/ Ines (dar)

Answers

Answer:

Le dio un collar a su hijo

Explanation:

I hope this is what you are asking

Le dio un collar a su hijo

HELP ME FAST PLEASEEEE

Answers

Answer: uh can you plz put it in english

Explanation:

What does it mean by GO?

una forma de comunicarse inmediatamente

Answers


a way to communicate immediately

SPANISH 1
In one sentence, state which room is your favorite and why. (e.g., My favorite room in the house is the kitchen because I love to eat.)
In one sentence, describe where the room is in relation to other rooms in the house, using the correct form of the verb estar and at least two location prepositions (next to, in front of, to the left of, etc.) (e.g., The kitchen is between the living room and the dining room and near the garage.)
In one sentence, state at least three items that you can find in that room using adjectives. (e.g., There is a white stove, a tall refrigerator, and a brown table.)
In one sentence, state at least two activities that you do in the room, using the present tense yo form of the verbs. (e.g., I eat dinner and do my homework in the kitchen.)

Answers

En mi casa , mi cuarto favorito es el baño . A mi me gusta el baño porque en El baño es donde puedo hacer del baño en paz . El baño De mi casa esta junto la sala y enfrente de mi cuarto . En El baño tengo mi maquillaje , mi ropa , y mi sepillo de dientes . En mi baño hay Una regadera y UN espejo grande en medio. En El baño a mi me gusta sepillarme El pelo . Tambien me gusta lavarme la Cara . Finalmente , me enchants echarme UN baño caliente en las noches

Explanation:

sonce my keyboard is in English it made some of the words capitalized when they werent suppose to be so just fix that and your good

To tell which is your favorite room in a house and why, in the Spanish language, you can use the following example "Mi habitación favorita de la casa es la sala de estar, porque me encanta hablar y ver la televisión con mi familia."

To describe where the room is in relation to other rooms in the house, you can use the preposition of location '"al lado", as for example:

La sala de estar está al lado del balcón, desde donde puedo ver el jardín y el movimiento de personas y autos que pasan.

A phrase state at least three items than you can find in the room, using adjectives, it can be:

En la sala hay un sofá de cuero, una alfombra bordada y una mesa de comedor de madera donde mi familia y yo comemos.

A phrase state at least two activities than you do in the room, using the present tense form of the verbs, it can be:

En la sala de estar veo la televisión con mi familia, juego videojuegos y como mis comidas.

Learn more here:

https://brainly.com/question/18229677

Choose the correct demonstrative adjective for the noun blusa.
A. Esta
B. Este
C. Estas
D. Estos

Answers

A. esta is the answer. If the word was plural blusas it would have been b. estás . Keep in mind if the word ends in a the adjective would also be ending in A!

Answer:

a

Explanation:

i had this on my assignment and ik how to talk spanish.

Mi papá y yo ____ ________ las manos. (lavarse) Present Tense *​

Answers

mi papá y yo nos lavamos Las manos

7.4 ¡Indicale cómo ir!
Estás en una ciudad nueva y no sabes ir al hotel. Un peaton te explica cómo llegar a tu destino. Completa las instrucciones con los mandatos usando los
verbos entre paréntesis. Usa también las palabras derecha, izquierda o recto, según indican las flechas (arrows).

Primero, ____
(salir) Ud. por aquí y _____
(ir) tres kilómetros al norte. Luego, ___
(doblar) a la
(-) en la calle que está
inmediatamente antes de la estación de tren. Después, ___
(seguir) __
(1) 200 metros ____
(doblar) a la ___
() en la calle principal y
(cruzar) ____ el puente.
(pasar) __por el centro y la oficina de correos. Finalmente,
(manejar) ____ 200 metros hasta llegar al Hotel Florida. ¡Ah! y si Ud. tiene problemas,
(volver) ____ a
preguntar.

Answers

Answer:

salga

vaya

doble

im not sure about this one but :➡️Derecha, ⬅️Izquierda.

Siga

doble

im not sure about this one but :➡️Derecha, ⬅️Izquierda.

cruce

pasará

maneje

vuelva

Complete the bottom portion pls help I don’t understand will give brainliest

Answers

Answer:

1- frie

2-hierve

4-agrega

5-cocinan

6-mezclamos

I TRIEDDD!

Hey Abby girl wanna go on a date with me

Decide whether the sentence is corect or incorrect as written.
No te importa las decisiones.
O correct
O incorrect

Answers

Incorrect.
The correct form to write the sentence would be “No te importan las desiciones”

Answer:

O incorrect

Explanation:

No te importa las decisiones.   (incorrect)

No te importan las decisiones.    (correct)

I need help completing the first section pls help first to answer gets Brainliest

Answers

tu deshaces el problema y yo deshaco
1. Deshaces Deshago
2. Traen traigo

How are Mexico and Spain similar? Give multiple examples.

Answers

Their languages sound the same or very similar

Write an article in Spanish for your school newspaper about the first tryout rounds of a school talent show called Idolo de México. Describe the abilities and talents of the participants and their shortcomings. Be sure to use the subjunctive mood wherever appropriate.

Answers

The correct answer to this open question is the following.

"Nervios, Risas y Talentos, durante la primera eliminatoria de Idolos de México.

Unos tenían prisa por maquillarse. Otros no dejaban de calentar su voz. Los pocos, rezaban antes de salir al escenario.

No importaba el talento o la experiencia; la mayoría de alumnos estaba muy nervioso.

Y es que interpretar a los grandes ídolo de México, no es una tarea fácil.

Imagínate. La lista es interminable. El gran cómico Mario Moreno "Cantinflas." O el inmortal Pedro Infante, el "Ídolo de México." O qué decir de Jorge Negrete, el "Charro Cantor." O la destreza del pachuco, Germán Valdés "Tin Tan."

Todos los participantes en la primera fase eliminatoria tenían talento, sin embargo, la presión y los nervios no los dejaron desempeñarse como se debe.

Juan, se equivocó en la letra de la canción. María, no se aprendió los parlamentos. Ana no llegó al tomo correcto. Pedro se cayó al intentar un paso de baile.

No importa, así comenzaron las grandes estrellas. Equivocándose la primera vez.

Escoge el artículo y adjetivo correcto de la siguiente palabra:

casa

Answers

translation of the question: pick the correct article & adjective that belongs to the following word
una would be the article since casa is feminine & singular! also, grande would be the adjective, as casa is singular, but it would come AFTER the word itself (just because adjectives work like that in spanish)
so it’d be written as: “una casa grande”
which translates to: a big house

are these correct if not help me . If good at Spanish help . In preteriré form

Answers

Answer:

Yes, they're all correct

Explanation:

1. the first one mis amigos y yo is nosotros. this means we will use the nosotros form of practicar so the answer is practicamos

2. is correct

3. is correct

HELP PLEASEEEEEEEEEEE

Answers

Answer:

Escoje la respuesta correct. ¿Quién está en el aeropuerto?

A. los pasajeros está en el aeropuerto.

B. los pasajeros están en el aeropuerto.

C. los pasajeros son en el aeropuerto.

D. los pasajeros son altos.

Hope this helps!

Answer:

the second one - los pasajeros están en el aeropuerto

Explanation:

Conjugate the verbs in the left column in the 'yo' form in the present
tense and choose a logical ending to form complete sentences. Use each
verb one time only and use each ending from the right column one time
only.
1. Salir
2. Poner
3. Traer
4. Hacer
mi tarea en la clase de matemáticas
música en mi carro
de mi casa a las 7:30 de la mañana
la television en la noche
la verdad a mi novio/a siempre
mis programas favoritas en HULU
mi libro y un lápiz a la clase de
español
5. Ver
6. Oír
7. Decir

Answers

Answer:

Explanation:

Yo salgo de mi casa a las 7:30 de la manana

(I leave my house at 7:30 in the morning)

Yo hago mi tarea en la clase de matemáticas

(I do my Homework in math class)

Yo traigo mi libro y lápiz a la clase de español

( I bring my book and pencil to Spanish class)

Yo oigo música en el carro

(I listen to music in the car)

Yo pongo la televison en la noche

(I "turn on"/ put on/ watch TV at night)

Yo veo mis programs favoritos en HULU

( I watch my favourite programs on HULU)

Yo le digo la verdad a mi novio/a siempre

(I always tell my boy/girl friend the truth)

Decide if the following definite article and noun agreement is correct or incorrect. Las boligrafos

Answers

Answer:

Incorrect.

Explanation:

It's masculine, so you need los instead of las

very wrong. los instead of las because it’s male

Fill in the blanks with the appropriate forms of the adjectives.

Simpático
1.La profesora Martínez es ______.
2.Rosa y Teresa son ____.
3.Nosotros somos _____.

Azul
4.El papel es ____.
5.Las maletas son _____.
6.Los libros son _____.

Alemán
7.Mis primas son _____.
8.Marcus y yo somos ___.
9.Mi tía es ____.

Guapo
10.Mis sobrinas son ____.
11.Los padres de ella son _____.
12.Marta es ____.

Answers

Answer:

simpatico

1. simpatica

2. simpaticas

3. simpaticos

azul

4. azul

5. azules

6. azules

aleman

7. alemanas

8. alemanes

9. alemana

guapo

10. guapas

11. guapos

12. guapa

Explanation:

don't forget to add acento to the ones that need it

The correct form of the adjectives in each case is:

La profesora Martínez es simpática. Rosa y Teresa son simpáticas. Nosotros somos simpáticos.  El papel es azul. Las maletas son azules. Los libros son azules.  Mis primas son alemanas. Marcus y yo somos alemanes. Mi tía es alemana.  Mis sobrinas son guapas. Los padres de ella son guapos. Marta es guapa.

Translation.

Professor Martínez is nice. Rosa and Teresa are nice. We are nice.  The paper is blue. The suitcases are blue. The books are blue.  My cousins are German. Marcus and I are German. My aunt is German.  My nieces are pretty. Her parents are handsome. Marta is pretty.

The adjectives.

In Spanish, adjectives have both gender and number, which means that they can be singular or plural, but at the same time they can be masculine or feminine, depending on the person, animal or thing to which they refer.

Taking into account the above, and taking as an example the first adjective given in the exercise "simpático," an adjective could take the following forms:

Simpática: feminine and singular. Simpáticas: feminine and plural. Simpático: masculine and singular. Simpáticos: masculine and plural.

Therefore, to properly select the adjective, you must identify the gender and number of the person, animal or thing it characterizes, then use an adjective corresponding to it.

More information on adjectives:

https://brainly.com/question/13260766?referrer=searchResults

what is the purpose of the audio?(1 point) For the doctor to describe medical school For the doctor to give suggestions on well being

Answers

The purpose of the audio is B. For the doctor to give suggestions on well-being

What is the purpose of the audio?

The acoustic range of human hearing is defined as audio. It is the audible portion of the sound frequency spectrum, as opposed to inaudible sounds heard by certain animals or used in science and medicine.

The wordings in the audio include "my name is doctor Ledezma and I have some tips for you don't eat so much fat exercise to stay healthy find a hobby to keep your mind busy don't eat so much sweets"

Therefore, based on the information given, the correct option is B.

Learn more about audio on:

https://brainly.com/question/27676139

#SPJ1

Complete question

Listen to the audio, read the question, and choose the option with the correct answer.

(Audio: mi nombre es doctor Ledezma y tengo unos consejos para usted no coma tanta grasa haga ejercicios para mantenerse saludable busque un pasatiempo para mantener la mente ocupada no comas tantos dulces)

What is the purpose of the audio? (1 point)

A.For the doctor to describe medical school

B.For the doctor to give suggestions on well-being

C.For the doctor to recall facts about body parts

D.For the doctor to talk about former patients

1
Los turistas tienen unas horas para
descansar en sus habitaciones
leer una revista
visitar la ciudad

Answers

No hay revista ??? Si puede, adjuntar el enlace de la revista a continuación.

Un señor es un niño
true or false? ​

Answers

Answer:

Si

Explanation:

Todos eran un nino en su tiempo de vida.

—Hola, soy Carlota y tú eres mi esposo Frank. Hoy es la quinceañera de ________ sobrina, Elena. —¿Tienes ________ pantalones para la fiesta, Frank? —No. La fiesta es a las 3. Estoy a tiempo para comprar unos pantalones. (2 points) nuestro; tus nuestro; tu nuestra; tus nuestras; tu

Answers

Answer:

1) nuestra sobrina

2)nuestros pantalones

Answer:

—Hola, soy Carlota y tú eres mi esposo Frank.

Hoy es la quinceañera de ___nuestra_____ sobrina, Elena.

—¿Tienes ___tus_____ pantalones para la fiesta, Frank?

—No. La fiesta es a las 3. Estoy a tiempo para comprar unos pantalones.

Escucha varias canciones de Ana Tijoux. ¿Qué temas te llaman la atención? ¿Por qué?

Answers

Los temas que llaman la atención de la cantante Ana Tijoux son:

AntipatriarcaSacar la vozMalLimón y sal (acompañamiento con Julieta Venegas)

¿Quién es Ana Tijoux?

Es una cantautora francesa con nacionalidad chilena la cual se centra en los géneros hip hop y rap en español, teniendo mucha notoriedad debido a canciones como 1977 y acompañamientos a reconocidos cantantes como Julieta Venegas.

Los temas de sus canciones suelen abordar problemáticas como la violencia de género y la falta de equidad hacia las mujeres, por lo cual temas como "antipatriarca" o "sacar la voz" pueden ser de los más sonados dentro de las personas que gustan del género.

Más información sobre Música en Español: https://brainly.com/question/2004242

Completa las siguientes oraciones de manera lógica.
Each word will be used only once.
¿Cuánto cuesta una computadora que
un escáner grande?
¿Tiene computadoras que
imprimir?
¿Hay agendas electrónicas que
estudiantes?
¿Hay alguna tienda que
abierta?
¿Sabe si hay alguna computadora que no
escáner?

Answers

Answer:

How much does a computer cost

a big scanner?

Do you have computers that

to print?

Are there electronic agendas that

students?

Is there a store that

open?

Do you know if there are any computers that

scanner?

Explanation:

Los deportistas _______ en el gimnasio.
O se entrena
O entrenar
O quieren entrenarse
O entrenarse​

Answers

Answer:

quieren entrenarse

Explanation:

i know spanish...hope this helps

Which answer has the correct order of good morning, good afternoon and good evening?
O buenos días, buenas noches, buenas tardes
buenas tardes, buenas noches, buenos días
O buenos días, buenas tardes, buenas noches
O buenas noches, buenos días, buenas tardes

Answers

The second one is the correct order

Answer:

Buenos dias, buenas tardes, buenas noches

Explanation:

I know spanish, i have AP spanish this year

Johnny___ _______. (afeitarse) Present Tense​

Answers

Johnny se afeita ! Hope this helps :)

Read the sentence and select the price that most closely matches the motorcycle’s description.

Mi motocicleta es cómoda, rápida, grande, atractiva y es la más cara de todas. Su precio es

Answers

Do you have a picture of the problem?

Answer: treinta y cinco mil dólares

Explanation: took test

Other Questions
A certain relationship is defined as having only one corresponding y-value for each x-value. Which of the following best describes this relationship? A. variable B. expression C. function D. equation 1. Use the following graph to determine the coordinated of the y-intercept.A. (5,0)B. (4,0)C. (0,4)D. (0,5)HURRY!!! Please. How does the theme that stories can help us understand oneanother develop in "The Speech"? 2 The density of a substance can be determinedby finding the unit rate that compares mass tovolume. A nugget of gold has a mass of463.2 grams and a volume of 24.0 milliliters.What is the density of gold?F 11,116.8 g/mLG 439.2 g/mLH 0.052 g/mLJ 19.3 g/mL Answer #1 and #2 for Brainliest! Plz answer if you know and not just for points Though Shaka was a great African leader he was unable to keep his kingdom intact against the superiorweapons of the British. The Zulus became part of British controlled land in 1887. Many of the whiteImperialists believed it was their duty to then convert natives to western cultural values. The discovery ofdiamonds and gold in southern Africa created a world rush to exploit fortunes from these products for thecolonizers. The legacy of this time period is complex. The mixing of cultures has led to new culturalgroups such as peoples in Mexico with indian and Spanish blood. Colonization also led to the rise of manyruthless military leaders who had little experience with democracy or human rights leaving many colonizedareas struggling in the modern age.Select the best word because the paragraph mentions African leaderAssimilationNatural rights/EnlightenmentEconomicsPolitics/ExecutiveNatural ResourcesConquistadors/Absolute powerWhite Man's BurdenIndirect ruleBud A medium pizza at Benny's Pizza costs $13.60 plus $2.50 for each topping. At Ricco'sPizza, a medium pizza costs $14.60 plus $2 for each topping. For how many toppingswill the pizzas cost the same price?O 2 toppingsO They will always cost the same. 1 toppingO They will never cost the same. Please help! 20 points and brainly!!Which ratio forms a proportion with 14/42? 1/4 7/21 12/40 28/80(Please explain how you got the answer) What are all the secrets to the universe ? 25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT