Find the least common multiple of 7,9 and 21

Answers

Answer 1
Free LCM Calculator determines the least common multiple (LCM) between 9 and 21 the smallest integer that is 63 that is divisible by both numbers. Least Common Multiple (LCM) of 9 and 21 is 63.
...
Prime Factorization of 21.
3 21
7 7
1

Related Questions

The altitude of a triangle is increasing at a rate of 1 cm/min while the area of the triangle is increasing at a rate of 2 cm^2/min. At what rate is the base of the triangle changing when the altitude is 10 cm and the area is 120 cm^2?

Answers

Answer:

The base is decreasing at 2 cm/min.

Step-by-step explanation:

The area (A) of a triangle is given by:

[tex] A = \frac{1}{2}bh [/tex]   (1)

Where:

b: is the base

h: is the altitude = 10 cm

If we take the derivative of equation (1) as a function of time we have:

[tex] \frac{dA}{dt} = \frac{1}{2}(\frac{db}{dt}h + \frac{dh}{dt}b) [/tex]

We can find the base by solving equation (1) for b:

[tex] b = \frac{2A}{h} = \frac{2*120 cm^{2}}{10 cm} = 24 cm [/tex]

Now, having that dh/dt = 1 cm/min, dA/dt = 2 cm²/min we can find db/dt:

[tex] 2 cm^{2}/min = \frac{1}{2}(\frac{db}{dt}*10 cm + 1 cm/min*24 cm) [/tex]

[tex]\frac{db}{dt} = \frac{2*2 cm^{2}/min - 1 cm/min*24 cm}{10 cm} = -2 cm/min[/tex]    

         

Therefore, the base is decreasing at 2 cm/min.

               

I hope it helps you!  

CAN SOMEONE PLZ HELP MEI BEG U ILL DO ANYTHING JUST HELP ME!!!!

Answers

Answer:

you can draw < > ≤ ≥ as duck mouths or something.

and the symbol ≠ can be inputed as a wire or dog leash, so if I had to draw this, draw a park where there is a lake on the right side then have a bench where an old man or a little child is feeding ducks with little bits of breab with its beaks opened then have like, a girl jogging with her dog and put ≠ as a leash for the dog and that's all I got. If you want more add street lights hanging above like triangles.

Let the factors, a1, a2, … a9 of a9 be written in a square 3 by 3 array as indicated. Let a1 Help me plz

Answers

Answer:

61.2

Step-by-step explanation:

To solve this, we would have to use the arithmetic progression formula

S(n) = a + (n - 1) d, where

S(n) = is the value of the nth term

a = value of the first term

n = the nth term we're interested in

d = difference between successive terms

We're given that the first term, a1 = 1.we also know that the 6th term, a6 = 44

If so, we can use this to get our "d", saying

44 = 1 + (6 - 1) d

where

44 is the value of the 6th term, and n is 6. Also, the first term a = 1. Simplifying further we have

44 = 1 + 5d

5d = 44 - 1

5d = 43

d = 43/5

d = 8.6

This means that the difference between successive term is 8.6, we then use this "d" to find our 8th term

S(n) = 1 + (8 - 1) 8.6

S(n) = 1 + 7 * 8.6

S(n) = 1 + 60.2

S(n) = 61.2

Therefore, the 8th term is 61.2

your class is having a car wash for a fundraiser. it costs $27.95 for supplies. your class charges $5 per car. write an expression for the profit of the car. find the profit if the class washes 34 cars.​

Answers

Equation y = 5x - 27.95
Plug in 34 for x
5(34) - 27.95
170 - 27.95 = $142.05

Answer:

5x-27.95=profit

5(34)-27.95

170-27.95

$142.05

36/ BLANK= 12/ BLANK FILL IN THE BLANKS PLEASE

Answers

Answer:

All real numbers

Step-by-step explanation:

36/something1 = 12/something2

36/12=3

to get from something1 to something2 you divide by 3

36/3x=12/x

Cross multiply

36x=12*3x

36x=36x

x=x

Since each side of the equation is equal, the solution is all real numbers

I hope this helps :)

To finish a certain job in 8 days, 6 workers are needed. If it is required to finish the same job in 2 days advance, how many workers have to work? *
8 points

Answers

Answer:  96 workers

Step-by-step explanation:

First you multiply 8 and 6 then by 2.

8 x 6= 48

48 x 2= 96

96 workers to help the business

Find the coordinates of the reflection: B (7,-1) is reflected over the x-axis B’=?

Answers

Answer:

(7;1)

Step-by-step explanation:

The abscissa of B' is going to be the same as abscissa of B , becuse the points are simmetrical over axis x.

However the ordinate of the point B'  will have the opposite sign as ardinate  B. However the module of ordinate B'  is going to be the same as module of orrdinate B.

(7,1) because when you reflect over the x axis you will change the value of y, and vice versa

The figure shown is a parallelogram.
What are the values of x and y?

Answers

Answer:

x=6 and y= 15 I think im correct don't take my word for it

how many terms are there in the expression 2x - 3y + 8?​

Answers

Answer:

Three. 2x, -3y, and 8.

Step-by-step explanation:

For every constant or variable, there is a term.

In this expression, there are two variables (x and y) and there is a constant (8).

Hence, there are three terms.

Hope this helped!

A random sample of 1028 adults in a certain large country was asked​ "Do you pretty much think televisions are a necessity or a luxury you could do​ without?" Of the 1028 adults​ surveyed, 521 indicated that televisions are a luxury they could do without.

Answers

Answer:

lol

Step-by-step explanation:

what is the question

*Find 6 5/8% of $1,480.90. Round to the nearest cent.

Answers

9514 1404 393

Answer:

  $98.11

Step-by-step explanation:

If your calculator doesn't work with mixed numbers, you must first convert 6 5/8% to a decimal fraction.

  6 5/8 = (6·8+5)/8 = 53/8 = 6.625

  6 5/8% = 0.01×6.625 = 0.06625

Then the desired amount is ...

  0.06625 × $1480.90 = $98.109625 ≈ $98.11

6 5/8% of $1,480.90 is $98.11.

the charge for a 7 min call is Rs.42.
find the rate per min ​

Answers

42 dollars/7 minutes

÷ by 7 on both

6 dollars/1 minute

hope this helped

please make this brainliest

ASAP HELP PLEASE ITS IS VERY NEEDED

Answers

Answer:

D. no solution because the other answers if you plug them in dont work

Dan and Paul share some money in the ratio 9:5.
Dan decides this is unfair so he gives Paul £32 of his share to make the ratio 1:1.
How much did Paul originally have?

Answers

Answer:

Paul had £40 originally.

Step-by-step explanation:

Given

Let d be the money Dan has and p be the money Paul has

Then according to the given situation,

[tex]\frac{d}{p} = \frac{9}{5}\\d = \frac{9p}{5}\ \ \ Equation\ 1[/tex]

Now from the statement, "Dan decides this is unfair so he gives Paul £32 of his share to make the ratio 1:1"

[tex]\frac{d-32}{p} = 1[/tex]     Eqn 2

From 2

[tex]d - 32 = p\\[/tex]

Putting d = 9p/5

[tex]\frac{9p}{5} - 32 = p\\9p - 160 = 5p\\9p-5p = 160\\4p = 160\\\frac{4p}{4} = \frac{160}{4}\\p = 40[/tex]

Checking

[tex]d = \frac{9(40)}{5} = \frac{360}{5} = 72\\\frac{d}{p} = \frac{72}{40} = \frac{9}{5}[/tex]

Hence,

Paul had £40 originally.

The larger of two numbers is four more than three times the smaller. Two times the smaller, increased by five, results in the larger. What are both numbers?

Answers

Answer:

Determine the area of the archway with a semicircle top arch and two rectangular pillars.

The lower supports are

✔ congruent rectangles

and the area of the two supports is

✔ 24

square meters.

The upper arch can be decomposed as one semicircle with radius

✔ 6

meters minus a semicircle with radius 3 meters.

The area of the archway is (

✔ 13.5

π + 24) square meters.

Step-by-step explanation:

Cuánto le falta a 3/5para llegar a 9/10

Answers

Answer:

3/10

Step-by-step explanation:

3/5 se puede convertir en 6/10

(3x2)/(5x2).

9/10 - 6/10 = 3/10

le falta 3/10 para llegar a 9/10.


PLEAS HELP FAST!!!!!!!!!!!!!!

Answers

Answer: Point D

Step-by-step explanation: Point D is at 3 and 3/4.

I think the answer is point D


Ava was looking for treasure.
She looked on a sandy beach. The
length of the beachy spot was 2 1/4
feet by 1 1/2 feet. What was the
area of the beachy spot?

Answers

2 1/4 x 1 1/2
= 9/4 x 3/2
= 27/8
= 3 3/8

Need help with statistics question please.

25. Filling Bottles A certain brand of apple juice is supposed to have 64 ounces of juice. Because the punishment for under filling bottles is severe, the target mean amount of juice is 64.05 ounces. However, the filling machine is not precise, and the exact amount of juice varies from bottle to bottle. The quality-control manager wishes to verify that the mean amount of juice in each bottle is 64.05 ounces so that she can be sure that the machine is not over- or under filling. She randomly samples 22 bottles of juice and measures the content and obtains the following data:
64.05 64.05 64.03 63.97 63.95 64.02 64.01 63.99 64.00 64.01 64.06 63.94 63.98 64.05 63.95 64.01 64.08 64.01 63.9 63.97 64.10 63.98

(a) Because the sample size is small, she must verify that the amount of juice is normally distributed and the sample does not contain any outliers. The normal probability plot and box plot are shown. Are the conditions for testing the hypothesis satisfied?

(b) Should the assembly line be shut down so that the machine can be re calibrated? Assume =0.06 ounces and use a 0.01 level of significance.

(c) Explain why a level of significance = 0.01 of might be more reasonable than 0.1 [Hint: Consider the consequences of incorrectly rejecting the null hypothesis.]

Answers

Answer: Hmm this question was very hard.

Step-by-step explanation:

write a poem about linear functions.

Answers

Answer:

what are linar functions

Step-by-step explanation:

If a line has a rise of 2 and a run of 2, what is its slope

Answers

Answer:

It's a positive slope it's not going down it's going up every time you go up to you go over to making it a positive slope

Step-by-step explanation:

FOR 20 POINTS!!!!! Luis has $12 and wants to buy 6.6 pounds of apples. Apples cost $1.80 per pound. Luis rounded each value and estimated that he does not have enough money to cover the cost of the apples before sales tax is applied. Which best explains how his estimate relates to the actual product? Because each value rounds up, his estimate is higher than the actual product. He might have enough money to buy the apples. Because each value rounds up, his estimate is higher than the actual product. He does not have enough money to buy the apples. Because each value rounds up, his estimate is lower than the actual product. He does not have enough money to buy the apples. Because each value rounds up, his estimate is lower than the actual product. He might have enough money to buy the apples.

Answers

Answer: Hope this helps.

Because each value rounds up, his estimate is higher than the actual product. He might have enough money to buy the apples. So A.

Step-by-step explanation:

We don't actually know what it was that Luis was estimating. Assuming he was estimating the cost of the apples he wants to buy, rounding up both the price and quantity will give an estimate of $2/lb × 7 lb = $14, which is more than he has to spend.

Luis could refine his estimate by realizing the actual price is 10% less than the vaue he used, and the actual quantity is not quite 6% less than the value he used. The amount Luis has is about 14% less than the cost he estimated, so considering estimation errors, he probabaly has enough money.

The best choice among the answers is the one shown above.

helppppp please I will give brainliest​

Answers

It is y=2x-4 (the 4th answer)

how do i solve this help

Answers

Answer is : A .. Hope it helped

Suppose that E and f are two events and that P(E and F)=0.3 and P(E)=0.5. What is P(F/E)?

Answers

Answer:

[tex]P(F/E) = 0.6[/tex]

Step-by-step explanation:

If we are given two dependent events [tex]A[/tex] and [tex]B[/tex] such that their chances of occurrence or the probabilities of the events are: [tex]P(A)[/tex] and [tex]P(B)[/tex].

Then the conditional probability that the event [tex]B[/tex] will occur given that [tex]A[/tex] has already occurred is given by the following formula:

[tex]P(B/A) = \dfrac{P(A \cap B)}{P(A)}[/tex]

Here the two events given are [tex]E[/tex] and [tex]F[/tex].

[tex]P(E\ and\ F)\ or\ P(E\cup F) = 0.3[/tex]

and [tex]P(E) = 0.5[/tex]

As per the above formula that we have already discussed, the formula can be written as:

[tex]P(F/E) = \dfrac{P(E \cap F)}{P(E)}\\\Rightarrow P(F/E) = \dfrac{0.3}{0.5}\\\Rightarrow P(F/E) = \dfrac{3}{5}\\\Rightarrow \bold{P(F/E) = 0.6}[/tex]

Jan raised $120.75 at the car wash. If each wash costs $5.75, how many cars did she wash?

Answers

Answer:

She washed 21 cars

Step-by-step explanation:

Answer:

Jan washed 21 cars

Step-by-step explanation:

120.75 / (Divided) 5.75=21

If you were to times 5.75 by 21 you will get the amount she rasied at the car wash

What is the measure of 1 Explain

Answers

Answer:

what measure one

Step-by-step explanation:

What are u talking bout

There is no picture or anything

Answer:

I wish I could help.

Step-by-step explanation:

There is no picture or a complex explanation.

How many distinct rearrangements of the letters in "tweedledee" are there?

Answers

Answer:

weed ,led ,we, tee , tweedle

Estimate 296/26 by first rounding each number so that it has only 1 nonzero digit

Answers

Answer:

10

Step-by-step explanation:

296/26 = 11.3846153846

Now round it to the nearest tenth = 11.40

round to the nearest whole number = 11

To the nearest zero digit = 10

Answer:

Step-by-step explanation:

296 .Here ten's place is 9 >= 5 . So, add 1 to hundred's place

296 = 300

26. Here units place is 6 >= 5 . So, add 1 to ten's place

26 = 30

[tex]\frac{296}{26}=\frac{300}{30}=10[/tex]

In the library on a university campus, there is a sign in the elevator that indicates a limit of 16 persons. Furthermore, there is a weight limit of 2500 lb. Assume that the average weight of students, faculty, and staff on campus is 151 lb, that the standard deviation is 25 lb, and that the distribution of weights of individuals on campus is approximately normal. If a random sample of 16 persons from the campus is to be taken:

a. What is the expected value of the sample mean of their weights?
b. What is the standard deviation of the sampling distribution of the sample mean weight?
c. What average weights for a sample of 16 people will result in the total weight exceeding the weight limit of 2500 lb?
d. What is the chance that a random sample of 16 persons on the elevator will exceed the weight limit?

Answers

Answer:

Explained below.

Step-by-step explanation:

According to the Central Limit Theorem if an unknown population is selected with mean μ and standard deviation σ and appropriately huge random samples (n > 30) are selected from this population with replacement, then the distribution of the sample means will be approximately normally.  

Then, the mean of the sample means is given by,

[tex]\mu_{\bar x}=\mu[/tex]

And the standard deviation of the sample means is given by,

[tex]\sigma_{\bar x}=\frac{\sigma}{\sqrt{n}}[/tex]

a

The expected value of the sample mean of their weights is same as the population mean, μ = 1515 lbs.

b

The standard deviation of the sampling distribution of the sample mean weight is:

[tex]\sigma_{\bar x}=\frac{\sigma}{\sqrt{n}}=\frac{25}{\sqrt{16}}=6.25[/tex]

c.

The average weights for a sample of 16 people will result in the total weight exceeding the weight limit of 2500 lbs. is:

[tex]\text{Average Weight}=\frac{2500}{16}=156.25[/tex]

d

Compute the probability that a random sample of 16 persons on the elevator will exceed the weight limit as follows:

[tex]P(\bar X > 156.25)=P(\frac{\bar X-\mu_{\bar x}}{\sigma_{\bar x}}>\frac{156.25-151}{6.25})\\\\=P(Z>0.84)\\\\=1-P(Z<0.84)\\\\=1-0.79955\\\\=0.20045\\\\\approx 0.20[/tex]

Other Questions
Which of the following benefits do member of Congress not receive?retirementsalaryimmunity from arrestallowance (6th grade math) yasiara has 3/4 of cake. she wants to divide it up into 1/12 size pieces. how many pieces will she have? ( can you show work please) Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason