Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer 1

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

Graded For Correctness: In Humans, The Ability To Digest Lactose Beyond Childhood Is Determined By A

Related Questions

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

Chloroplasts do photosynthesis in which plant structure?
A. stem

B. leaves

C. roots

Answers

The answer will be b

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

List the changes that occur in the zygote after fertilization that contribute to human development

Answers

Answer:

Hello! Sorry i am late! Here is my best answer below.

Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

Sorry if this is not what you were looking for! Hope this helps you! Have a great rest of your day or night and good luck on your work!

<3 <3 <3

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

The diagram shows part of an aquatic food web
for a stable lake ecosystem in Connecticut.
Turtles
Large fish
Small fish
Aquatic insects
Tadpoles
Water fleas
Rotifers
Algae
What is the source of energy for the algae?
A waves
B. sunlight
C. bacteria
D. rotifers, water fleas and tadpoles

Answers

Answer:

Sunlight

Explanation:

I just got it wrong because of the wacko below or above me gave me the wrong answer

Algae possess chlorophyll in their cells. They use carbon dioxide in a manner that is analogous to how we use food. Thus, option B is correct.

What is a characteristic feature of algae?

By converting light energy to chemical energy through the process of photosynthesis, carbon dioxide and water are transformed into organic molecules.

Nearly all algae engage in the process, and in fact, much of what is currently known about photosynthesis was first uncovered through research on the green alga Chlorella.

Like other plants, algae benefit from sunlight, therefore denying them of it will limit or even completely stop their growth. For several days, completely shading the tank or aquarium from light is essential.

Therefore,  algae require sunshine because algae can photosynthesize, or use sunlight to change carbon dioxide into biological material.

Learn more about algae here:

https://brainly.com/question/13921782

#SPJ2

2 Lin sulks during the first week of rehearsals because she is – A tired from working on the set B bored with her duties as a designer C confused about the directions given to her D disappointed with the assignment she received​

Answers

Answer:

skull tropper

Explanation:

I got it from the guy from fortnite

what story is that from

PLZ HELP 25 POINTS!!!

Give an example of how Eubacteria can be harmful. Explain.

Answers

Answer: However, bacteria can also cause disease. Examples of bacterial diseases include tetanus, syphilis, and food poisoning. Bacteria may spread directly from one person to another. For example, they can spread through touching, coughing, or sneezing. Some Eubacteria can induce serious diseases such as tuberculosis, meningitis, anthrax, leprosy, cholera and tetanus. Antibiotics disrupt normal functioning of bacterial ribosomes or synthesis of the cell wall and prevent further multiplication of bacteria in the body.

Explanation:

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

A false-positive csf serologic test for neurosyphilis in a treated patient can occur if:

Answers

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).

A false-positive CSF serologic test for neurosyphilis in a treated patient can occur due to various factors. These factors include contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs). The cerebrospinal fluid (CSF) serologic test is a significant diagnostic tool used in the diagnosis of neurosyphilis. However, it has been observed that this test can produce false-positive results, even in treated patients. This can occur due to various reasons, including contamination, serologic cross-reactivity, the persistence of nontreponemal antibodies, a rebound phenomenon, and biological false positives (BFPs).Contamination: This is one of the most common reasons for false-positive results in CSF serologic tests. This can occur due to errors during the collection, transport, and processing of the specimen. Even minor contamination can lead to false-positive results in these tests. Therefore, it is essential to ensure that the sample is appropriately collected, handled, and processed.Serologic cross-reactivity: Another reason for false-positive results in CSF serologic tests is serologic cross-reactivity. This occurs when the antibody produced in response to an infection or vaccination reacts with the antigen of another microorganism. In the case of neurosyphilis, cross-reactivity can occur with other spirochetes such as Borrelia burgdorferi, which causes Lyme disease.The persistence of nontreponemal antibodies: The nontreponemal antibodies produced in response to syphilis can persist even after the treatment. These antibodies can lead to false-positive results in the CSF serologic test, even though the patient has been adequately treated. Therefore, the presence of nontreponemal antibodies should be taken into account while interpreting the test results.A rebound phenomenon: The rebound phenomenon is another reason for false-positive results in CSF serologic tests. This phenomenon occurs when there is a rapid decrease in the antibody titer after the treatment, followed by a rapid increase. This can lead to false-positive results, even if the patient has been adequately treated.Biological false positives (BFPs): BFPs are a rare phenomenon that can lead to false-positive results in CSF serologic tests. This can occur due to a genetic mutation or immunological condition that leads to the production of an antibody that reacts with the antigen in the serologic test.

To know more about cerebrospinal fluid visit: https://brainly.com/question/13050022

#SPJ11

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

The Gulf of Mexico dead zone is an area of hypoxic waters at the mouth of the Mississippi River. Its area varies in size, but can cover up to 6,000-7,000 square miles. The zone occurs between the inner and mid-continental shelf in the northern Gulf of Mexico, beginning at the Mississippi River delta and extending westward to the upper Texas coast. Thousands of farms are located along the Mississippi River and its tributaries and as water washes into the river after a heavy rain, it brings with it nutrients from fertilizers added to farmland. These materials flow downriver and eventually enter the Gulf of Mexico, where they create conditions for a dead zone: an area of low to no oxygen that results in the death of fish and other marine life. The Gulf of Mexico is a major source area for the seafood industry. The Gulf supplies 72% of U.S. harvested shrimp, 66% of harvested oysters, and 16% of commercial fish. Consequently, if the hypoxic zone continues or worsens, fishermen and coastal state economies will be greatly impacted. What can be done to minimize the Gulf dead zone? Choose ALL that could apply. A) Control of animal wastes so that they are not allowed to enter into waterways. B) Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland. C) Monitor septic systems and sewage treatment facilities to reduce discharge of nutrients to surface water and groundwater. D) Restrict land use in the areas surrounding the Mississippi delta to exclude industrial sites. E) Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

Answers

This Is Confusing Could U put more Details

The things that should be done to minimize the Gulf dead zone include:

A. Control of animal wastes so that they are not allowed to enter into waterways. B. Adjust the timing of fertilizer applications to limit runoff of excess nutrients from farmland.E. Counter the effects of fertilizers on algal growth in the Gulf with the use of chemical herbicides.

It should be noted that it's important to manage nutrients efficiently in farmlands through the restoration of wetlands in order to capture nutrients and then reduce runoff.

In order to minimize the Gulf dead zone, there should be control of animal wastes so that they are not allowed to enter into waterways. Also, there should be an adjustment of the timing of fertilizer applications to limit runoff of excess nutrients from farmland.

Read related link on:

https://brainly.com/question/17876202

What is a negative feedback loop? Provide an example NOT related to Biology. (I will give brainliest)

Answers

Answer:

Examples of processes that utilise negative feedback loops include homeostatic systems, such as Thermoregulation if body temperature changes, mechanisms are induced to restore normal levels) Blood sugar regulation (insulin lowers blood glucose when levels are high glucagon raises blood glucose when levels are low)

Explanation:

Answer: A negative feedback loop is basically a procedure that uses criticism to make positive changes to a process

Ferns tend to live in which of the following habitats?"
moist and sunny
moist and shady
O dry and sunny
Odry and shady

Answers

Answer:

Moist and shaddy

Explanation:

moist and shady
hope it helps

Can throat cancer be inherited?

Answers

Most throat cancers are generally related to smoking and not hereditary, unless the family members are predisposed to smoking.

No not really. Only genes

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

According to catastrophists what was the rate of geological change?

Answers

Catastrophism is the theory that the Earth has largely been shaped by sudden, short-lived, violent events, possibly worldwide in scope.[1] This is in contrast to uniformitarianism (sometimes described as gradualism), in which slow incremental changes, such as erosion, created all the Earth's geological features. The proponents of uniformitarianism held that the present was the key to the past, and that all geological processes (such as erosion) throughout the past were like those that can be observed now. Since the early disputes, a more inclusive and integrated view of geologic events has developed, in which the scientific consensus accepts that there were some catastrophic events in the geologic past, but these were explicable as extreme examples of natural processes which can occur.

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

Which of the following is the correct binomial format? O Genus species O Phylum class O Species O Order family

Answers

The correct option is A, The correct binomial format is "Genus species."

Genus species is a scientific naming convention used in taxonomy to classify and categorize living organisms. It represents the two main levels of classification below the higher taxonomic ranks of family, order, class, phylum, and kingdom. The genus refers to a group of closely related species that share common characteristics and ancestry. It is always capitalized and italicized when written in scientific literature.

The species name, on the other hand, is a specific epithet that further distinguishes individual organisms within a genus. It is written in lowercase and also italicized. The combination of the genus and species names provides a unique binomial nomenclature for each organism, enabling scientists to communicate and identify species consistently. For example, Homo sapiens represents the genus Homo (including humans and their close relatives) and the species sapiens, which is specific to modern humans.

To learn more about Genus species visit here

brainly.com/question/30346312

#SPJ4

Mom has O blood and dad has O blood. What blood type(s) will their children have?

Answers

Answer:

A mother who is blood type O can only pass an O allele to her son or daughter. A father who is blood type AB could pass either an A or a B allele to his son or daughter.

Explanation:

Hope this helped :)

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

nad is directly involved a) only glycolysis b) only ppp c) both pathways d) neither pathway

Answers

NAD (Nicotinamide adenine dinucleotide) is directly involved in (C) both glycolysis and the pentose phosphate pathway (PPP).

In glycolysis, NAD acts as a coenzyme and plays a crucial role in the redox reactions of the pathway. During the conversion of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, [tex]NAD^{+}[/tex] is reduced to NADH. This reduction reaction allows NADH to carry high-energy electrons to the electron transport chain for ATP production.

In the pentose phosphate pathway, [tex]NADP^{+}[/tex] (a phosphorylated form of NAD) serves as a coenzyme. [tex]NADP^{+}[/tex]is utilized in the oxidative phase of the pathway to facilitate the oxidation of glucose-6-phosphate to generate NADPH. NADPH is an important reducing agent used in biosynthetic processes, antioxidant defense, and reductive reactions within the cell.

Therefore, NAD is directly involved in both glycolysis (in the form of NADH) and the pentose phosphate pathway (in the form of [tex]NADP^{+}[/tex] and NADPH). The correct answer is option C) both pathways.

Learn more about NAD (Nicotinamide adenine dinucleotide):

https://brainly.com/question/30323008

#SPJ11

!PLEASE ANSWER ASAP! How much of farmed aquaculture in the US consists of oysters?

Answers

two thirds

Explanation:

a 30 rock cut cave monuments famous for its murals



Ineeditnow​

Answers

Answer:

Ajanta Caves

Explanation:

do you agreed that cell is a building unit of organism yes explain why?class 9​

Answers

Answer:

It can be, but not really

Explanation:

This is because cells can be the building block of an organism, e.g. humans, but they can also be their own separate organism, such as a bacteria.

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

_____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) View Available Hint(s) _____ in carbon dioxide in your red blood cells, which causes _____ in pH, causes your breathing to speed up. See Concept 42.6 (Page) A decrease ... a drop An increase ... a rise An increase ... a drop A decrease ... a rise Actually, it is the rise and fall of oxygen, not carbon dioxide, that controls breathing.

Answers

Answer:

1 An increase

2 A drop

Explanation:

T/F. short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window.

Answers

The statement "short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window" is true.

To provide a more accurate explanation:

The cochlea, a spiral-shaped structure in the inner ear, plays a crucial role in the process of hearing. Within the cochlea, the basilar membrane is a key component that vibrates in response to sound waves.

When sound waves enter the ear, they travel through the auditory system and reach the cochlea. The oval window, which is located at the base of the cochlea, receives these sound vibrations and sets the fluid inside the cochlea into motion. This motion causes the basilar membrane to vibrate.

The basilar membrane is structured in a way that it varies in width and stiffness along its length. This variation allows different regions of the basilar membrane to respond selectively to different frequencies of sound. The base of the cochlea, near the oval window, is narrower and stiffer, while the apex of the cochlea is wider and more flexible.

High-pitched sounds, which have short wavelengths and higher frequencies, specifically cause displacement of the basilar membrane near the base of the cochlea, close to the oval window. This region of the basilar membrane is more responsive to high-frequency sounds. As a result, the basilar membrane near the oval window detects and responds to these short-wavelength, high-pitched sounds.

In summary, short wavelengths from high-pitched sounds cause displacement of the basilar membrane near the oval window, as this region is specifically responsive to high-frequency sounds.

To know more about wavelengths follow the link:

https://brainly.com/question/31143857

#SPJ4

Other Questions
Personal Trainer, Inc. owns and operates fitness centers in a dozen Midwestern cities. The centers have done well, and the company is planning an international expansion by opening a new "supercenter" in the Toronto area. Personal Trainer's president, Cassia Umi, hired an IT consultant, Susan Park, to help develop an information system for the new facility. During the project, Susan will work closely with Gray Lewis, who will manage the new operation. Background System changeover and data conversion were successful for the new Personal Trainer system. The post-implementation evaluation indicated that users were pleased with the system. The evaluation also confirmed that the system was operating properly. Several users commented, however, that system response seemed slow. Susan Park, the project consultant, wants to meet with you to discuss operation, maintenance, and security issues affecting the new system. Tasks 1. What might be causing the slow response time? Prepare a brief memo explaining system performance and workload measurement, using nontechnical language that Personal Trainer users can understand easily. (25 points) 2. What could be causing the network slowdowns at Personal Trainer? If a problem does exist, which performance and workload measures would you monitor to pinpoint the problem? (25 points) 3. At the end of the systems analysis phase, you studied the economic feasibility of the system and estimated the future costs and benefits. Now that the system is operational, should those costs and benefits be monitored? Why or why not? (20 points) 4. You decide to prepare a security checklist for Personal Trainer. Prepare a list of security issues that the firm should evaluate and monitor. Be sure to organize the items into categories that match the six security levels. (30 points) which microorganism is capable of independently invadingplant's roots determine the number of electron groups around the central atom for each of the following molecules. Match the similarities between an electrical circuit and water circuit.1. PSI A. battery2. pipes B. open circuit3. pump C. ammeter4. valve D. switch5. restriction E. amps6. water meter F. resistance7. water G. + voltage8. high pressure output H. - voltage9. low pressure intake I. closed circuit10. valve closed J. electrons11. valve open K. volts12. liters/second L. conductors a scientist claims that 7% of viruses are airborne. if the scientist is accurate, what is the probability that the proportion of airborne viruses in a sample of 679 viruses would be greater than 8% ? round your answer to four decimal places. 10. In which of the following situations will the divorced non-custodial parent be entitled tothe dependency exemption for the child? Assume that the divorce decree is silent regarding the dependency exemption for the child.A. The custodial parent provides $2,700 of support for the child and the dgusb) nornon-custodial parent provides $3,200.B. The custodial and non-custodial parents each provide $2,300 of support for the child.C. The custodial parent provides $2,500 of support for the child and the non-custodial parent provides $1,200.D. The custodial parent provides $2,500 of support for the child, the non-custodialparent provides $2,900, and the child has gross income of $2,000.E. None of the above Suppose you are consuming two goods, A and B. Your marginal utility of good A is 28, and your marginal utility of good B is 3. The price of good A is $2100, and the price of good B is $2.00. a. In this case, you are [not maximizing your total ublity b. You should consume: Instructions: You may select more than one answer. Click the box with a check mark for correct answers and click to empty the box for the wrong answers. more of good A less of good A more of good B less of good B 15 of 15 Prex 8. What Scope does fuel for its fleet fall in? Define this Scope.9. Should the upstream emissions for gasoline be included in Region Banks carbon footprint? Why or why not? If they are, is there a risk of double counting?10. What are the carbon emissions (or CO2 equivalents) from commuting by the Banks employees?11. Should this be included in the Banks carbon footprint? What Scope does employee commuting fall in? Define this Scope. Which action would shift this reaction away from solid lead chloride and toward the dissolved ions?O adding lead ions O adding chloride ionsO removing chloride ionsO removing lead chloride A dart is tossed uniformly at random at a circular target with radius 3 which has its center at the origin (0,0). Let X be the distance of the dart from the origin. Find the cumulative distribution function (cdf) of X. the following equation shows the formation of water from hydrogen and oxygen. 2h2 o2 2h2o how many grams of water will form if 10.54 g h2 reacts with 95.10 g o2? g h2o Solve the system of linear equations using the Gauss-Jordan elimination method. (If there is no solution, enter NO SOLUTION. If there are infinitely many solutions involving one parameter, enter the solution using t for the last variable.) 3x - 2y + 4z = 30 2x + y 2z = -1 x + 4y - 8z = -32 (x, y, z) vadim has a piece of evidence that contains visible data. which type of evidence does vadim likely have? group of answer choices print spool file Consider the following scenario analysis:Rate of ReturnScenario Probability Stocks BondsRecession 0.20 5 % 14 %Normal economy 0.60 15 8 Boom 0.20 25 4 b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 decimal place.) If Taxpayer requests an extension of time to file her individual tax return, the latest she may pay any tax due without penality is In a perpetual inventory system, two entries are normally made to record each sales transaction. The purpose of these entries is best described as follows:a.One entry recognizes the sales revenue and the other recognizes the cost of goods sold.b. One entry records the purchase of merchandise and the other records the sale.c. One entry records the cost of goods sold and the other reduces the balance in the Inventory account.d, One entry updates the subsidiary ledger and the other updates the general ledger Which of the following is not a factor affecting the number of lamps required?A ) Fixture efficiencyB ) Lamp lumen outputC ) Room size and shapeD ) Availability of natural lightE ) # of people in the room Last year Nicole bought 200 shares of Burlington common stock at $255.00 per share. During the year he received dividends of $3.50 per share. Currently, the shares were sold for $302.00. What is the rate of return earned by Nicole for the year?Answer: Yield=_____________________________________Show Formula and Procedure (explanation) Each data point on a scatter plot representsa. the frequency of occurrrenceb. a pair of scoresc. a score on one measurementd. none of these Erica came to Australia from the United States on a working holiday on 1 December 2019 when she finished college. Her parents were separated, and she had been living between their houses over the last 3 years. All her belongings were packed in a box and stored in her father's basement when she left for Australia. Over the last 7 months Jane has worked in various jobs in Sydney staying with various friends and relatives then she went travelling down the east coast of Australia. At the end of September 2020, she left for New Zealand and intends to go back to the United States in 2022. 1 Outline the tax residency consequences for Erica. Explain your answer with reference to the relevant legislative provisions, case law and the relevant guidance provided by the ATO.