How did French authorities control their colonial territories in Indochina?
A. By convincing influential religious leaders to publicly support
French leadership
B. By using a powerful military to get revenge on any groups that
harmed French citizens
C. By preventing native peoples from accessing modern technology.
such as railroads
OD. By practicing tolerance toward native cultural practices and
religious beliefs

Answers

Answer 1

French authorities control their colonial territories in Indochina by  By using a powerful military to get revenge on any groups that harmed French citizens. Thus option (B) is correct.

What type of government did the French impose on those in Indochina?

The form of the government used by the french to impose its rule on the Indochina was done through the influence of the western style and exploited them economically.

The Governor-General presided over the French administration in Indochina, which was supported by a network of other government organizations.

The Governor-General shared ultimate authority with numerous French residents. By employing a potent military to exact retribution on any groups that injured French residents, French authorities maintain control over their former colonies in Indochina.

Therefore, The correct option is (B)

Learn more about French administration here:

https://brainly.com/question/23154685

#SPJ1


Related Questions

What promises did NAFTA keep?

Answers

Since NAFTA's adoption, several corporations have actually relocated their operations to Mexico and Canada, rather than creating jobs in the United States. This is further explained below.

What promises did NAFTA keep?

Generally, NAFTA  is simply defined as The North American Free Trade Agreement (NAFTA) was an experiment that established a new paradigm for international trade agreements.

In conclusion, NAFTA failed in there Promises.

Read more about NAFTA

https://brainly.com/question/7458065

#SPJ1

Compare a republic to a democracy.
How are they similar ?
How are they different?

Answers

Answer:

see explanation

Explanation:

Similarities:

a democratic and republic state can have more than 1 democratic/republic typeboth have free market economiesfair elections are supportedfreedom to practise any religion

Differences:

Republic originates from Latin, democracy originates from Greek3 types of democracy, 5 types of republicin a democratic state, laws are made by the majority. In a republic state, laws are left up to a representative of the people (person in power; government)

Use the excerpt to answer the question.

Which of the following BEST captures the message George W. Bush directed at the terrorists in his speech?

A.
Fight fairly, or we will assemble a global alliance.

B.
Don’t expect conventional tactics.

C.
We already know how to beat you.

D.
We will defeat you with words, not weapons.

Answers

The option that captures the message or theme George W. Bush directed at the terrorists in his speech is D. We will defeat you with words, not weapons.

What is a theme?

It should be noted that a theme simply means the underlying message that is conveyed by a author or speaker.

In this case, the option that captures the message or theme George W. Bush directed at the terrorists in his speech is that we will defeat you with words, not weapons.

Learn more about theme on:

brainly.com/question/11600913

#SPJ1

Which sentence from "Island of Hope, Island of Tears" is written using a cause-and-effect text structure?

A. Her brother placed a housework-wanted ad in a local paper, and Katherine was soon hired as a governess with a wealthy family.

B. After a brief courtship, he and Vida Dixon married and sailed to the United States in 1923.

C. His brother Salvatore followed in 1908 and their siblings Antonio, Maria Anna, and Angelina joined them in 1913.

D. The Sicurella family typified the kinds of professions many Italian immigrants undertook once they came to America in the early 1900s.

Answers

Answer:

c

Explanation:

i did it and its correct

Who was Orval Faubus and what was he known for?
A.
Supreme Court justice who overturned Plessy v. Ferguson
B.
lawyer who argued against segregated seating on Montgomery buses
C.
governor of Arkansas who used the National Guard to prevent school integration
D.
a South Carolina senator who called for resistance to school integration

Answers

Orval Faubus was the governor of Arkansas and he was known for the use of the National Guard to prevent school integration

This is further explained below.

Who is Orval Faubus?

Generally, an American politician Orval Eugene Faubus was born January 7, 1910, and died December 14, 1994, He was the 36th Governor of Arkansas.

In conclusion, The all-white Central High School in Little Rock, Arkansas, barred black pupils on September 2, 1957, prompting Governor Orval Faubus to bring out the Arkansas National Guard.

Read more about Orval Faubus

https://brainly.com/question/22975760

#SPJ1

Malcolm X left the Nation of Islam because he
advocated violent resistance.
changed his beliefs.
wanted to join King's organization.
felt conflicted about his role in the Watts riots.

Answers

Answer:

heleftislambecausemalcolmxchangedhis b3Liefs

Explanation:

i have to say it like this because itll delete it otherwise.

Answer:

B- Malcolm changed his beliefs.

Explanation:

The person who posted first had said it, but with difficulty. I also commented what they had said under their post.

why are socialist systems more likely than capitalist systems to provide public health programs

Answers

Socialist systems are more likely to provide public health programs dude to the fact that they are controlled by the government unlike the capitalist systems that are controlled by private persons.

What is the socialism system?

This is the system of government that lies in the hands of the state or the government. The government is the central planning head of the place.

They help to provide the social welfare that the people need and also help to decrease economic fluctuations.

Read more on the socialist system here;

https://brainly.com/question/839803

#SPJ1

The Federal Trade Commission acts primarily as a
A.consumer protection agency.
B.national central bank.
C.federal oversight committee.
D.regulatory body for tariffs and taxes.

Answers

A.

Explanation:

The basic statute enforced by the FTC, Section 5(a) of the FTC Act, empowers the agency to investigate and prevent unfair methods of competition, and unfair or deceptive acts or practices affecting commerce. This creates the Agency's two primary missions: protecting competition and protecting consumers.

(hoped this helped)

Why is cyberbullying psychologically harmful to members of the LGBTQ community

Answers

Explanation:  

Cyberbullying is psychologically harmful to members of the LGBTQ community because, in the 21st century, technology is a major part of society. People's lives revolve around technology and LGBTQ members can potentially be subjected to cyberbullying every day.

LGBTQ individuals are harassed because of an identity that they can not control nor change, and this damages their self-confidence and mental health, spurring them to believe that their existence is "wrong."

Capitalism is another term for a
traditional
market
mixed
command
economic system.

Answers

Answer:

command economic system.

Explanation:

Why did fighting along the Western Front create a stalemate during World
War I?
A. Trench warfare allowed both sides to defend their positions
against large-scale attacks.
B. New transportation technology allowed both sides to rapidly
deploy armies along the front.
OC. Military officers on both sides were unwilling to sacrifice their
soldiers by launching attacks.
OD. Disease epidemics left both sides unable to attack each other
for months at a time.
SUBMIT

Answers

B. new transportation technology allowed both sides to rapidly. i think

Which of the following political ideas was rejected by the puritans

Answers

Not only did they reject the idea of establishing a system of church courts, they also forbade ministers from holding public office.

pleaseee helppp :’)

Which diagram reflects an accurate cause-and-effect relationship during the
rise of big business and industry in the early 20th century?

Answers

the answer is A i am pretty sure

Ethnic conflict in Rwanda led to...
A two-party state
A division of the country into two nations
Genocide
Civil War

Answers

Answer:

Genocide

Explanation:

Hutu killed Tutsi

Genocide happened in 1994

Now Rwanda is known to be one of the fastest growing African countries in Information and Communication Technology

rdb.rw

Help me out please !!!!

Answers

F
“Theodore Roosevelt announced his 1912 platform at the chicago convention of the progressive party “

Which two countries pull many tales of legendary warriors from well-documented wartime eras in their actual history

Answers

Tow countries that pull many tales of legendary warriors from well-documented wartime eras in their actual history are C. China and Japan.

China has been in existence for a long time as a series of empires and then as the nation it is today. In that time, it has had many warriors as a result of the many wartime eras that the country has gone through.

Japan is another nation that has also been around for a while. As an isolated empire, they had some devastating internal wartime eras in their histories that made the names of some warriors into legends from shoguns to emperors.

What are wartime eras?

Wartime eras refer to a period in a nation's history that was marked by several wars, battles, and different types of violent conflict. These include civil wars and wars with other nations.

China is a nation that has been in existence for a long time as a series of empires and then as the nation it is today. In that time, it has had many warriors as a result of the many wartime eras that the country has gone through.

Japan also has been around for a while. As an isolated empire, they had some devastating internal wartime eras in their histories that made the names of some warriors into legends from shoguns to emperors.

Find out more on China's wartime eras at https://brainly.com/question/17384615.

#SPJ1

Which is an action of Andrew Jackson's that made his opponents angry?

Answers

Answer:

He deposited all of the national government’s money in various state banks around the country.  

Explanation:

Andrew Jackson did not like the Second Bank of the United States. He removed all of the national government’s money and forced the Second Bank to close making opponents angry. Edge 2022.

Answer:

Destruction of the National Bank

Explanation:

One of the many reasons was that he constantly raised war with the national bank of America. He also expanded executive power, and one propaganda poster describes him as "King Andrew"

How did the Hawley-Smoot Tariff help spread the Depression overseas?

Answers

Answer:

The Smoot-Hawley Act increased tariffs on foreign imports to the U.S. by about 20%. At least 25 countries responded by increasing their own tariffs on American goods. Global trade plummeted, contributing to the ill effects of the Great Depression.

Explanation:

Who was king Baudoin the First

Answers

Answer:

baudoin the first

Explanation:

Baudouin  7 September 1930 – 31 July 1999 Dutch name Boudewijn, was King of the Belgians from 17 July 1951 until his death in 1993. He was the last Belgian king to be sovereign of the Congo.

Born: 7 September 1930; Stuyvenberg Castle, ...

Father: Leopold III of Belgium

Died: 31 July 1993 (aged 62); Villa Astrida, Mo...

The Han Dynasty implemented which of the following?
O the spread of Buddhism
O a strong violent monarchy
O the Mandate of Heaven
O the belief that all things are God

Answers

Answer:

the spread of Buddhism

Explanation:

Which of the following is an example of a famous poem written in Sanskrit?

A. Karma

B. The Ayurveda

C. Bhagavad

D. Arjuna’s Life

Answers

Answer:

Which of the following is an example of a famous poem written in Sanskrit?

c) Bhagavad

Bhagavad is an example of a famous poem written in Sanskrit. Thus option C is correct.

What is a poem?

A poem can be defined as a literary device. Which is made up of stanzas online. It may have a rhyming scheme or use of simile or metaphor. A poem is generally written by a poet. In a poem, the poet is trying to represent various things. the meaning can be direct or indirect. It also depends on the reader and their understanding.

The Bhagavad Gita is indeed a poem that was composed in Sanskrit. The shloka is the main of several traditional Indian poetry meters that are used to compose its 700 lines. It includes a total of 18 chapters. The text is composed of 1,400 lines because every shloka is composed of a couplet. Therefore, option C is the correct option.

Learn more about poem, Here:

https://brainly.com/question/12155529

#SPJ2

 

What did the Munich Pact of
1938 state that Hitler had to do
in exchange for Germany
getting the Sudetenland, a part
of Czechoslovakia?
A. finish paying war debts from the first world
war
B. go no further in his conquest of European
countries
C. pay for reparations from his bombing
campaign in Great Britain
D. pull troops out of France and Russia

Answers

The Munich Pact stated that if Hitler wanted the Sudentenland, he had to B. go no further in his conquest of European countries.

What did the Munich Pact say?

It was intended to stop Hitler from continuing his trend of taking over more territory for Germany.

As a result, it included the stipulation that once he got the Sudentenland, he would not go any further in trying to gain more European countries.

Find out more on the Munich Pact at https://brainly.com/question/289094.

#SPJ1

Why the United States experience a shifts from an industry based economy to a service based economy

Answers

Answer:the shift to services happens because the service sector is stagnant and less progressive

Explanation:the shift towards services takes place mainly due to the service sector's lower productivity, higher costs and thus higher relative prices than those in the manufacturing sector.

Why did hitler die (10 sentences)

Answers

Answer: he died by killing himself

Explanation:

How did economic policy motivate the United States to expand its interests overseas in the late 19th and early 20th centuries?
A. The United States desired access to technological innovations in other nations.
B. The United States lacked the domestic wealth to spend on its own production.
C. The United States lacked a large enough workforce to supply its factories.
D. The United States produced more goods than it could consume at home.​

Answers

Answer:  A. The United States desired access to technological innovations in other nations.

Answer: C. The United States lacked a large enough workforce to supply its factories.

Explanation: brainlest?

What is the role of ancient si ma?

Answers

Answer:

What were Sima's functions? To administer military awards, organize military training, and enforce military laws.

Explanation:

Which of the following would not be a way we can cut back on our use of oil? © A. Using more public transportation O B. Using less heat in the winters O C. Using more heat in the winters O D. Using cars that are more fuel efficient

Answers

Answer:

Moving your family farther away from where you work

Explanation:

Can someone please write me a 3 paragraph judicial opinion on any chosen case??

Answers

Explanation:

Law does not function in vacuum. Law operates for and in the society; and it is influenced by the mores and attitudes of the society. Correspondingly, law is an instrument of social change. The law thus never can be static; it has to change constantly with the changes in the society. Judiciary plays a major role for this change since judges interpret and redefine the laws through their judicial decisions. The demands of the time and society become prominent factors for judge in the law interpretation process. Their judicial opinions consequently become precedents - 'settled' or 'established' law that can provide legal foundation for settling subsequent cases. Hence, those who are associated in the field of law have to read case judgments for their research or academic purposes.

Mere knowledge of legal rules is not enough to do research in law. It also needs the analytical skills to extract ratio, observation and to apply these principles in different factual situations. This paper endeavors to identify certain parameters, which by no means are exhaustive but are only enabling points which could help a researcher to read and understand the judicial opinion. To achieve the very purposes of reading, the yardstick is not mere the ability to read, but to comprehend very essence of what is written.

The author believes that when a judgment is written well with clarity and consistency, even a common man would be able to figure out the contours of law. Since the objective of any judgment or judicial opinion is justice, the judge's conveying skill and the reader's skill ought to converge upon a common end.

A source that is written or created bv a person who experienced an event
personally is called a

Answers

Answer:

The correct answer is a primary source.

Explanation:

A primary source is an original object or document - the raw material or first-hand information, source material  that is closest to what is being studied.

Primary sources vary by discipline and can include:

- historical and legal documents,

- eye witness accounts,

- results of an experiment

- statistical data

- artifacts

Hope this helps:) Goodluck!

What are your priorities? (5 Points)
List 5 priorities with full sentences that you must have in a vehicle. Explain why each of these priorities are important to you. Some potential priorities could be safety, style, size, gas mileage, comfort, low price, handling, reliability, comfort, power, number of seats, trunk space, etc…

Answers

Answer:

There is no right or wrong answer to this question. It is asking your opinion of which features you think are important for a vehicle (car) to have. Just read the list of examples it gave you and pick some of the. All of the examples given are important and useful features of a car, so just breifly explain why said features are useful.

Explanation:

Please give Brainliest, and have a great day!

Other Questions
Read these lines from Fredrick Douglass's speech "What to The Slave Is the Fourth of July?"The blessings in which you this day rejoice, are not enjoyed in common.Which of the following correctly defines the word common as it is used here?Of ordinary occurrence; usualOf the most familiar typeO Falling below ordinary standardsShared alike by all the persons in question HELP ME CJDUCIF PLEASE I WILL MARK BRAINLIST You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer