How did Squealer explain the situation to the animals?

Answers

Answer 1

When the animals object, Squealer explains that the pigs need milk and apples to sustain themselves as they work for the benefit of all the other animals.

What is the squealer's role in Animal Farm?

One of the three most significant pigs is a squealer. Like Snowball, he is intelligent, a skilled communicator, and very effective at winning over the other animals. He ends up serving as Napoleon's representative, giving commands, justifying his decisions, and telling lies in favor of Napoleon. As a skilled orator, Squealer utilizes language to persuade the other animals to believe the lies he tells them and to doubt what they have seen with their own eyes. By reminding the animals of how horrible life was under Jones's control, Squealer plays on their fear and threatens a return to this condition if they do not listen and submit to Napoleon's demands.

To learn more about Squealer refer to:

https://brainly.com/question/16580534

#SPJ4


Related Questions

How many types of verbal irony are there?

Answers

There are four sorts of linguistic irony in this basic definition: Sarcasm. Understatement. Overstatement.

Overstatement, exaggeration, and hyperbole are all examples of linguistic irony that accentuate the significance of what is being given.

Sarcasm (saying "Oh, terrific!" when the situation is truly terribly awful) Socratic irony (pretending to be uninformed in order to demonstrate that someone else is ignorant: "I'm perplexed, I thought your curfew was at 11 p.m...." understatement (stating "We don't get along" after a major argument with someone)

The three most popular types in literature classes are verbal irony, dramatic irony, and situational irony. Here are some well-known examples: "But Brutus claims he was ambitious; / And Brutus is an honourable guy." Shakespeare's Julius Caesar.

Learn more about to irony visit here;

https://brainly.com/question/1695719

#SPJ4

How do you use a Venn diagram?

Answers

Using overlapping circles or other shapes, a Venn diagram illustrates the relationships among two or more groups of items.

What is a Venn diagram?

A Venn diagram visually illustrates the differences between two or more concepts. The relationships between two or more sets of data are demonstrated using circles as an example. Each circle represents a distinct set of data.

Venn diagrams, which are widely employed to contrast and compare the characteristics of distinct data sets, are particularly useful for highlighting similarities and differences. In a Venn diagram, a circle stands in for each data collection.

Hence/Therefore,

To learn more about the Venn diagram from the given link

brainly.com/question/24713052

#SPJ4

What are irregular lines?

Answers

A phrase used to describe works of art that highlight the use of primarily straight lines and forms yet are created without the use of a straightedge. These lines frequently show the hand motion of the artist who drew them, and as a result, they may look blurry, uneven, or flawed, as in the works of Paul Klee or Mark Rothko.

Who are artists?

A person involved in the creation, practise, or demonstration of an art is said to be an artist. The typical use in academic discourse and daily speech solely refers to a visual arts practitioner. Although it is also frequently used in the entertainment industry, particularly in a professional setting, for musicians and other performers (although less often for actors). The English equivalent of the French word for artist, "artiste," is occasionally used in this context. Although it is acceptable, the term "artist" is rarely used to describe authors and is often only applied in critical circumstances.

Technical expertise is implied by the Greek term "techn," which is sometimes translated as "art." The Latin adjectival term "technicus" served as the basis for the English words technique, technology, and technical.

To learn more about artists from the given link

https://brainly.com/question/25729154#SPJ4

#SPJ4

What are irregular lines?

What are the 4 stages of play?

Answers

Functional play, constructive play, symbolic/fantasy play, and game with rules are the forms of play that Piaget claims children engage in to represent their level of cognitive development.

What is game with rules?A game with rules is any play in which the players are required to abide by certain regulations. The last kind of play that Piaget recorded is this one. Children need to be cognitively capable of understanding and remembering the rules before they can participate in this form of play successfully. The idea of "games with rules" teaches kids a crucial idea: that in order for us to all play the game of life effectively, there are rules (laws) that we must all abide by. Children are taught a crucial notion through "games with rules": that in order to play the game of life successfully, we all need to abide by the laws.

To learn more about rules refer:

brainly.com/question/16876429

#SPJ4

Is revenge justified in Hamlet essay?

Answers

Yes, the revenge is justified in Hamlet essay written by Shakespeare.

The fear is a justification for revenge therein failing to try and do thus can bring tragedy to Hamlet's life. the requirement to stick to his father's ghost justifies the revenge mission that Hamlet undertakes within the play. The ghost commands Hamlet to revenge his father's “foul and most unnatural murder”

Shakespeare's message concerning revenge in Hamlet could be a complicated one. In Hamlet's case, he felt he had an ethical obligation to retaliate his father's death. However, as playwright demonstrates, the trail of retaliation could be a untidy one with harmful repercussions and sometimes takes several innocent lives within the method.

To learn more about Hamlet here

brainly.com/question/3386851

#SPJ4

What are the main conflicts in the story and how are they resolved Of Mice and Men?

Answers

The main conflicts in the story Of Mice and Men is George and Lennie's desire to one day possess their own farm serves as the primary source of conflict. Their main objective is to make enough money to become financially independent guys who are not dependent on others for job.

The battle for survival that George and Lennie engage in is the primary conflict in Of Mice and Men. They move throughout places searching for employment as migrant laborers to sustain themselves, but this is made challenging since Lennie keeps getting them into problems. Through their own concerns about their own social and financial standings, the other characters mirror this battle to achieve stability.

After repeating their common goal of owning a farm one more time, George shoots Lennie in the back of the head to protect him from Carley's anger at the conclusion of Of Mice and Men.

For more such question on Mice and Men.

https://brainly.com/question/19164862

#SPJ4

What is your perception about reflexive and intensive pronoun?

Answers

A reflexive pronoun relates back to the sentence's subject, whereas an intensive pronoun emphasizes or amplifies a noun.

I, you, him, her, it, ourselves, yourself, and themselves are examples of the intensive/reflexive pronouns. An intense pronoun is one that emphasizes its antecedent and ends in "self" or "selves." Reflexive pronouns can be used to emphasize that someone performs it personally and not on behalf of anyone else. Reflexive pronouns are used when the same person is the subject and object. To stress the subject that person or thing and nobody else intensive pronouns are utilized. Similar to intense is intense. Something powerful is intense. A pronoun's reflexive/emphatic/intensive case is used to denote an activity that has an effect on the performer.

To learn more about intensive pronouns click here https://brainly.com/question/18269698

#SPJ4

Based on the author's word choices in paragraph 1, which word best describes the author’s tone?

(A) critical
(B) optimistic
(C) annoyed
(D) neutral

Read the passage.

The Great Pacific Garbage Patch

There’s been talk that there is a giant pile of trash floating out in the middle of the Pacific Ocean. According to some reports, the Great Pacific Garbage Patch is supposedly twice the size of the state of Texas. This has led many people to envision a humongous pile, both in height and breadth. However, this is a gross exaggeration. True, there is trash floating around in the Pacific, but it’s quite different from what has been portrayed in the media. Nonetheless, there is still cause for concern.

In an area of the northern Pacific Ocean where the northern jet stream and the southern trade winds create a high-pressure zone, the winds circulate in opposite directions. These winds create an area of 7.7 million square miles of circling water called the North Pacific Gyre, which covers most of the northern Pacific Ocean. In the middle of the gyre are pieces of plastic garbage. This garbage isn’t a huge pile of floating pieces of trash, peoples tossed-away coolers, broken pieces of furniture, or boat seat cushions. It’s more insidious than that.

Answers

Answer: (D) neutral

Explanation:


The author's tone in paragraph 1 is neutral because they are simply presenting information about the Great Pacific Garbage Patch without expressing any personal opinion or emotion. The author is not critical, optimistic, or annoyed, but simply stating facts and providing information.

Answer:

D.) Neutral

Explanation:

I say neutral because in the 1st paragraph the author was stating a fact and was saying that the garbage was really big and that it was twice the size of the state of Texas but when you keep reading he/she says that this is just an exaggeration. He wasn't being critical, optimistic or annoyed he/she was neutral, she/he wasn't really bothered by it.

Find the slope of (7,-4) and (7,-1) give a great expiation and u will get marked as brainiest.

Answers

Answer:

The slope is zero

Explanation:

X1 = 7   x2= 7

Y1= -4    y2= -1

Slope = [tex]\frac{y2 - y1 }{x2 - x1}[/tex]

= [tex]\frac{-1 - (-4)}{7-7} \\= \frac{-1 +4 }{0} \\= \frac{3}{0} \\= 0[/tex]

Answer:

Slope = 0

Explanation:

Formula we use,

→ Slope(m) = (y2 - y1)/(x2 - x1)

Now required slope will be,

→ m = (y2 - y1)/(x2 - x1)

→ m = (-1 -(-4))/(7 - 7)

→ m = (-1 + 4)/(7 - 7)

→ m = 3/0

→ [ m = 0 ]

Therefore, the slope is 0.

I want your help!
Can you do 3-5 min essay about The importance of Technology and its effects on the present and Future

Answers

Yes, a sample essay on the Importance of Technology and Its Effects on the future is given below. Note that this is an explanatory essay.

What is the sample essay given above?

Technology has become increasingly important in our daily lives, shaping the way we work, communicate, and access information. It has revolutionized many industries and has had a significant impact on the present and future.

One of the most significant implications of technology in the present is how it has changed the way we do business. Companies may now employ technology to improve efficiency and production by streamlining their processes. Furthermore, technological advancements have made it simpler for people to work remotely, providing for more flexible work arrangements.

Thinking forwards, technology is expected to continue to play a significant role in influencing civilization. It has the ability to disrupt sectors and open up new avenues for growth and development.

Learn more about explanatory essays:
https://brainly.com/question/14711260
#SPJ1

What did Douglas mean when he said he understood the pathway from slavery to freedom?

Answers

In 1845, Frederick Douglass wrote an essay entitled, “What to the Slave Is the Fourth of July?” In it, he reflected on the irony of celebrating the Declaration of Independence while slavery still existed in the United States.

In the essay, he wrote, “I understood the pathway from slavery to freedom.” Douglass was speaking of his own personal experience in understanding the pathway to freedom. As a former slave himself, he was acutely aware of the difficulties and challenges faced by enslaved people. Douglass was suggesting that even though slavery was still legal in the United States when he wrote his essay, there was a pathway to freedom – a path that began with knowledge and understanding. He was advocating for knowledge and education as the primary means of achieving freedom.

Learn more about Frederick Douglass at :https://brainly.com/question/1910366

#SPJ4

How can I improve my daily decision making?

Answers

I can improve my daily decision making by collecting the information about the particular situation.

Some of the ways which can helps me to improve my decision making are:

1. Make an arrangement

In the event that you realize you have a forthcoming choice to make, it can assist with making an arrangement.

2. Be decisive

Have a go at assuming control over the dynamic interaction. You could have a go at prompting a gathering on every decision's upsides and downsides and drawing courses of events for guarantee a speedy and useful choice.

3. Ask a specialist

Hearing one more point of view can assist with approving your choices and give you additional trust in your critical thinking skills. You could take a stab at asking a neighborhood master, or you can continuously ask a confided in companion.

4. Keep it in context

Take a stab at passing judgment on the worth of every choice. Rather than investing broad energy discussing more modest choices, for example, the textual style type for your organization writing, center around bigger choices.

5. Set cutoff times

Set time impediments for yourself on every choice you make. This can assist with limiting how long you need to alter your perspective or ponder choosing. You initially could have to find the significance of your choice.

To know more about decision making, visit here:

brainly.com/question/16407152

#SPJ4

A 3. What does lyric poem
lack or not have that is useful for finding the theme?
a title
complete sentences
a setting
plot

Answers

A Setting.

Modern lyric poetry is a formal genre of poetry that speaks of one's own sentiments or emotions, usually in the first person.

Modern lyric poetry is a formal kind of poetry that often uses the first person to communicate personal emotions or feelings. The misconception comes from the fact that it is not the same as song lyrics, despite the fact that song lyrics are frequently in the lyric form, nor is it the same as Ancient Greek lyric poetry, which was primarily limited to song lyrics or chanted verse.

The term "lyric" is derived from a type of Ancient Greek literature called the "Greek lyric," which was characterized by its accompanying music, typically on a stringed instrument called a kithara[a]. Both modern lyric poetry and current song lyrics use this term. The distinction between the three major categories of poetry—lyrical, dramatic, and epic—developed by Aristotle is what gives the term its significance in literary theory. One of earliest genres of writing is lyric poetry.

To know more about lyric poem, click on the link below:

https://brainly.com/question/2017971

#SPJ1

What is the tone or mood of Modest Proposal?

Answers

This also applies to his ironic, cynical tone, his modest suggestions. The Modest Proposal was written as a commentary on the indifference of the rich to the poor and the politicians to the Irish.

Tone, when used in conjunction with the written word, refers to the author's attitude and feelings toward the subject matter or audience in question. This tone is often reflected either in the point of view chosen or the words used.

It's a little ironic that a young child might be used as a snack. The narrator "humbly" offers his views on cannibalism as though they were completely respectable, oblivious to the fact that they are against all of the established norms.

The Modest Proposal to prevent the children of the poor from becoming a burden on their parents and the state and to make them beneficial to the public, commonly referred to as the Modest Proposal, was written anonymously by Jonathan Swift, It is a satirical essay of a published youth. 1729.

Know more about narrator here:

https://brainly.com/question/17415359

#SPJ4

What are the 4 types of conditioning?

Answers

There four types of  conditioning techniques included that Positive reinforcers, Negative reinforcers, Positive punishers and Negative punishers. Also there are two important concepts of conditioning are Classical and operant which is centrally focused to behavioral psychology.

Positive reinforcers means to the addition of a reward. Negative reinforcers means to the removal of a punishment. Positive punishers means to addition of a punishment. Negative punishers means to removal of a reward.

Both operant and classical result in learning and both suggested that a subject can adapted according their environment.the most effective type of conditioning is Delay conditioning.

Learn more about Positive reinforcers click on the link here:

https://brainly.com/question/14299460

#SPJ4

What is Mark Twain's message in The Adventures of Huckleberry Finn?

Answers

The Adventures of Huckleberry Finn is a novel by American author Mark Twain set in the pre-Civil War South that exposes institutionalized racism and tackles themes of freedom, civilization, and prejudice.

Huckleberry Finn explores the notion of liberty and the price, if any, at which a person is genuinely free in two basic views of freedom. Huck and Jim both want independence, but they have quite different notions about what that entails. This disparity is due, in part, to what each character believes he is gaining freedom from. Huck, for example, longs to be free of "civilized" society. Heavy clothing, formal schooling, and, of course, home life suffocate him: "Living in a house, and sleeping on a bed, tugged on me quite tight, basically."

To know more about Mark Twain:

https://brainly.com/question/12474660

#SPJ4

What are the 5 ASL parameters?

Answers

Answer:

handshape, palm orientation, movement, location, and expression/non-manual signals.

Explanation:

In American Sign Language (ASL), we use the 5 Parameters of ASL to describe how a sign behaves within the signer's space. The parameters are handshape, palm orientation, movement, location, and expression/non-manual signals.

How do you write a compare and contrast essay examples?

Answers

Selecting two or more themes that are tangibly related is the key to creating an effective comparison and contrast essay. Instead of stating the obvious, comparison and contrast are used to draw attention to subtle differences or unexpected similarities.

The topic sentence that comes first should include one aspect of the comparison between your first and second subjects. You might start by giving a general summary of the political institutions in each country if your paragraph's theme is state apparatus and your topics are two different countries.

A compare and contrast essay could

start with an introduction that gives background information and a thesis that states what you're comparing and why.a section in the body comparing and contrasting the two subjectsa section in the body comparing and contrasting the two topics

To know more about compare and contrast essay, click on the link below:

https://brainly.com/question/13817103

#SPJ4

What is an example of equivalent expressions?

Answers

3(x + 2) and 3x + 6 are equivalent expressions because the value of both the expressions remains the same for any value of x.

What is equivalent expressions ?Even though they have different looks, expressions that are equivalent do the same action. Two algebraic expressions that are equivalent have the same value when the variable is entered with the same value.A mathematical expression made up of variables, coefficients, constants, and operations like addition, subtraction, multiplication, and division is called an algebraic expression. In general, something is considered equal if two of them are the same. Similar to this, analogous expressions in mathematics are those that hold true even when they appear to be different. However, both forms provide the same outcome when the values are entered into the formula.

To learn more about algebraic expressions refer :

https://brainly.com/question/4344214

#SPJ4

What is the ratio of homozygous yellow with wrinkled seeds and homozygous round with green seeds in f2 of classical dihybrid cross is?

Answers

A dihybrid cross consists of two individuals with two distinct traits controlled by two distinct genes. The idea of a dihybrid cross was developed as a result of Gregor Mendel's study of pea plants that were either round or wrinkled, yellow or green.

What classical dihybrid cross is?

A dihybrid cross consists of two individuals who are heterozygous for two different traits. The individuals who display this feature are homozygous for it.

Therefore, 3:1:9:3. Is the ratio of homozygous yellow with wrinkled seeds and homozygous round with green seeds in f2.

Learn more about dihybrid cross here:

https://brainly.com/question/1185199

#SPJ4

Why does Beowulf not kill Grendel's mother?

Answers

Beowulf uses the magical sword to slay Grendel's mother in a cave after a challenging duel between the two of them.

Beowulf meets Grendel's mother in a cave. He strikes her with Unferth's Hrunting, his sword, but it cannot break her skin. He then drops the sword and uses only his fists to start beating the mother. "In his might, his tremendous hand-grip," he puts his trust. Grendel's mother is successfully knocked to the ground by Beowulf, but she promptly rises to her feet and sits on top of him. She tries to kill him with a knife, but Beowulf's armor protects him this time. After successfully removing her from himself, Beowulf notices and seizes a large sword.

At the end, Beowulf kills Grendel's mother.

To know more about Beowulf poem, visit,

brainly.com/question/1830314

#SPJ4

How might Rikki's character and actions help the reader determine the theme? (USE THE R.A.C.E METHOD FOR YOUR ANSWER)

Answers

"Rikki-Tikki-Tavi" is a short story set in India during the colonial era. The story is told in the third person through a narrator. In this story, a family with a small child named Teddy adopts a mongoose and names him Rikki-Tikki-Tavi. Rikki loves the family for saving his life after a monsoon washed him from his family burrow. He protects the family and garden animals from the cobras, Nag and Nagaina, who threaten the garden animals and want to kill Teddy and his family so they can take over the bungalow. Rikki battles the cobras and wins, saving the family and the garden.

Rikki and Nag

The story was written by Rudyard Kipling. Although a renowned writer, Kipling had very colonialist and racist viewpoints, which occasionally made their way into his stories. Rikki-Tikki-Tavi is unfortunately one of those tales.

"Rikki-Tikki-Tavi" Characters

The main characters of "Rikki-Tikki-Tavi" are:

Rikki-Tikki-Tavi: The protagonist of the story. A protagonist is usually the main character or hero of a story and is responsible for driving the plot forward. Rikki is a small, brave mongoose who lives with Teddy's family and protects the garden wildlife, Teddy, and Teddy's family. As the protagonist, Rikki personifies bravery, confidence, and loyalty. He is brave and full of confidence when he battles the cobra's Nag and Nagaina. He is loyal to Darzee, Darzee's wife, and his human family, and he stands up to Nag and Nagaina.

Nag and Nagaina: The male and female cobras who rule the garden of the family's home are the antagonists of this hero's journey-styled plot. Antagonists are often the villains of a story and usually represent an obstacle that the protagonist must overcome and defeat to reach a goal. Nag and Nagaina have different reactions when the story reaches the climax and Nagaina faces losing her eggs. She pleads with Rikki to spare her children, which shows her softer side. Ultimately, Rikki outwits and defeats the villains.

Teddy: The young British boy who saves Rikki-Tikki-Tavi and befriends him. When Teddy is attacked by the cobras, Rikki-Tikki-Tavi saves him, just as Teddy once saved Rikki. The young boy is innocent and appeals to the reader's memory of the purity and safety of childhood.

Teddy's mother: Alice is a sweet, kind, empathetic woman.

Teddy's father: He is a British soldier and a protective father. He acknowledges Rikki's bravery in saving Teddy, Alice, and him from the cobra Nag. Nagaina believes Teddy's father killed Nag and seeks vengeance by attacking Teddy.

Chuchundra: The muskrat in the garden who is afraid of the cobras and wants to avoid confrontation.

Karait: A snake in the garden (and antagonist) who tries to bite Teddy early in the story. Rikki kills Karait to protect Teddy.

Darzee: A tailorbird who lives in the garden with his wife and family. He is afraid of Nag and Nagaina, so he rarely leaves his nest. He is a silly character who sings and provides commentary but offers little help against the threat of the cobras.

Darzee's wife: She is an active character who is angry at Nag for eating one of her babies. She helps Rikki win the battle against the cobras by pretending to be wounded and providing a distraction.

Does The Yellow Wallpaper have a reliable narrator?

Answers

Poor storytelling skills are displayed by the narrator in the story "the yellow wallpaper," making it difficult to comprehend or comprehend.

Who serves as storytelling's primary objective?

Stories make facts come to life, making the abstract concrete, and, through the process of denoting, take the audience inside the head of a physicist or mathematician to help them comprehend the importance and practical use of such ideas (Ellis, 2005). According to Wells (1986), telling stories is a fundamental method of meaning creation.

How does wonderful narrative come about?

The best stories are simple to comprehend. They don't have to spend some time interpreting and afterwards absorbing them because they are spoken in a language that is appropriate for the target audience. Because the general lesson is straightforward to understand in summary, simplicity also aids with learnability.

To know more about storytelling visit :

https://brainly.com/question/1288466

#SPJ4

Why is parallel structure used?

Answers

Parallel structure, or parallelism, means using the same pattern of words to show that two or more words or ideas are of equal importance. Words and phrases within a sentence should not only match in structure, but also in tense.

Writers use parallel structure to add clarity to their writing, make it easier to understand and show that their writing is structurally and grammatically correct. Explore parallel structure examples to better understand the concept.In medias res is the plot device.

That enables authors to "come late" to their own story. It is a Latin expression that essentially means "in the thick of things." Sometimes writers prefer to start their novels in the middle rather than bothering to give their characters a past. An illustration would be Neil Gaiman's "American Gods," as we don't learn about each god's history right away.

To know more about parallel structure visit:

https://brainly.com/question/1674651

#SPJ4

How does Agile deal with compliance requirements?

Answers

Adopt a hybrid strategy,Adopt a full delivery life cycle,Focus on solutions, not just software,Take a goal-driven approach,Be enterprise aware like this Agile deal with compliance.

Scrum, ITIL, Agile Modeling, Kanban, Unified Process, COBIT, and many more methodologies are all included into the hybrid approach known as DA. Regulations frequently address a wide variety of topics, so you must adopt supplemental practises from several sources. Most laws include not only construction but the whole delivery lifespan. Value streams have their own life cycle, which DA supports. Agile teams with disciplined work products that can be consumed rather than merely "shippable software." This approach directs teams as they make process decisions, some of which will be influenced by regulatory compliance. Enterprise awareness, or the understanding that agile teams don't operate in a vacuum, is one of the DA Mindset's guiding principles.

learn more about principles Refer:brainly.com/question/7413269

#SPJ4

Why is effective communication skills so important when working with a person with dementia?

Answers

Communication skills so important when working with a person with dementia Cognitive and communication abilities of a dementia patient. Make eye contact with the other person and request that they look at you when one of you is speaking.

Dementia is a generic word that refers to a disease that impairs one's ability to recall, reason, and make decisions, which has an impact on their ability to carry out daily tasks. The most prevalent type of dementia is Alzheimer's disease.

Alzheimer's disease is a particular type of brain condition, but dementia is a broad phrase. It is distinguished by dementia-like symptoms that get worse with time. Early indications of Alzheimer's disease frequently include problems in memory, thinking, and logical abilities since the disease.

To know more about Dementia visit:

https://brainly.com/question/28846854

#SPJ4

What is Frederick Douglass speech what the black man wants about?

Answers

Frederick Douglass calls for Black Americans to have the right to vote and civic equality in a speech from 1865. Frederick Douglass advocated for government action to guarantee that Black Americans have access to land, voting rights, and civic equality.

What is the definition of "voting rights"?

Voting rights are a group of statutory and constitutional protections designed to guarantee that most adults have the opportunity to cast ballots in local, state, and federal elections.

Is it my responsibility or right to vote?

No one in the United States is required by law to vote in any local, state, or federal election. There have been numerous ratified constitutional amendments since the first election.

To know more about the voting rights visit :-

https://brainly.com/question/6826755

#SPJ4

Why does Katniss think Peeta Wouldnʼt understand about owing someone or paying back your debt )?

Answers

Katniss believes that since he is not from the Seam and has never had to battle to survive, only those who have experienced such challenges are aware of "paybacks."

How is Katniss in Peeta's debt again?

Because Katniss attempts to speak to the Avox at dinner, when doing so is prohibited, she has once again incurred Peeta's wrath.

What does Katniss realize about Peeta?

Katniss understands that Peeta actually likes her and isn't simply being fl*rtatious. Peeta first developed feelings for Katniss when she was five years old after her mother was mentioned by Peeta's father.

What are three reasons Katniss is suspicious of Peeta?

She believes that he may be behaving out of kindness at times, which is more perilous for her because she is aware that she won't be able to kill a kind Peeta Mellark. She is occasionally persuaded that he is plotting, misleading her and others. The dandelion picture reappears.

To know more about Katniss and Peeta visit:

https://brainly.com/question/16048651

#SPJ4

What is Adam Smith's main idea quizlet?

Answers

Adam Smith's main idea was regarding  the importance of free markets

Who was Adam Smith?

Adam Smith was born in 1723 and died in 1790. He was a moral philosopher and economist, usually regarded as the father of modern economics. Smith's work is both a pillar of contemporary philosophy and a key source of political and economic transformation throughout the last two centuries.

Adam Smith was one of the first thinkers of his day to assert that money is generated via productive effort and that self-interest encourages individuals to maximize the use of their resources. He said that profits derived from capital investments, and that money is directed to where it can make the most profit.

Therefore, Smith's ideas are the necessity of free markets, assembly-line manufacturing processes, and GDP which is formed the foundation for classical economic theory.

Learn more about Adam Smith here:

brainly.com/question/21764310

#SPJ4

What Makes Great Zimbabwe unusual in African architecture is the fact that it is?

Answers

Great Zimbabwe is exceptional both for its size and for the quality of its masonry. Rectangular blocks taken from adjacent granite outcroppings are used to build several of the structures.

What distinguishes Great Zimbabwe's architecture?

One of sub-Saharan Africa's most stunning architectural landscapes has been called Great Zimbabwe. 1 Apart from the colossal Egyptian architecture, it is the largest stone edifice that was created in Africa before the modern age.

The Great Enclosure, the largest ancient construction south of the Sahara Desert, is its most formidable structure and has walls as high as 36 feet and a length of about 820 feet. It was likely a royal house or a symbolic grain storage facility. The stone remnants of a long-gone city close to present-day Masvingo, Zimbabwe, are known as Great Zimbabwe. Great Zimbabwe was inhabited starting approximately 1100 CE, but people left it in the 15th century.

To know more about Great Zimbabwe visit:

https://brainly.com/question/28748473

#SPJ4

Other Questions
Describe how globalization has changed Dubai. Use visual clues from the image above as well as your own knowledge to support your answer. Oxalic Acid, a compound found in plants and vegetables such as rhubarb, has a mass percent composition of 26.7% C, 2.24% H, and 71.1% O. Oxalic acid can interfere with respiration and cause kidney or bladder stones. If a large quantity of rhubarb leaves is ingested, the oxalic acid can be toxic. The lethal dose (LD50) in rats for oxalic acid is 375 mg/kg. Rhubarb leaves contain about 0.5% by mass of oxalic acid. (Show your work, using the insert equation tool :) What is the empirical formula of oxalic acid PLEASEPLEASE ANSWER and if i get any more bots answering with links im gonna cry ive put this question 5 times Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots