If x:(x+3) = 2:3
find x

Answers

Answer 1

Answer: -6

Step-by-step explanation:

If x:(x+3) = 2:3, we can set up the following equation:

x / (x+3) = 2/3

Next, we can multiply both sides of the equation by 3 to get rid of the fraction on the right side:

3 * (x / (x+3)) = 3 * (2/3)

This gives us:

x / (x+3) = 2

Finally, we can multiply both sides of the equation by (x+3) to get rid of the fraction on the left side:

x = 2 * (x+3)

We can then solve for x by rearranging the terms on the right side of the equation:

x = 2x + 6

Subtracting 2x from both sides gives us:

x - 2x = 6

This simplifies to:

-x = 6

Finally, we can divide both sides of the equation by -1 to solve for x:

x = -6

Therefore, x = -6.


Related Questions

How do you graph 3 inequalities on a number line?

Answers

with the Application of Analytical geometry a dotted line is used to mark x=3  inequalities on a number line

what is Analytical geometry ?

Combining algebra and geometry is called analytical geometry. Analytical geometry aims to present geometric figures through algebraic equations in either a two-dimensional or three-dimensional domain.

solution:

The graph below shows the inequality 3.

All points that lie in the shaded area satisfy the equation x<3.

In other words, x can take any value less than 3.

x≠3 or any number that is greater than 3.

Since there is strict inequality,

i.e., x<3, the points that lie on the line

x=3 will not satisfy the equation.

Therefore, a dotted line is used to mark x=3.

To learn more about Analytical geometry from the given link

https://brainly.com/question/23036034

#SPJ4

What is a hole in a graph asymptote?

Answers

A hole in a graph asymptote is a point where the curve of the graph does not go through, but instead veers away from the point and goes towards an infinite value.

A hole in a graph asymptote is a point at which the curve of the graph does not go through, but instead veers away from the point and goes towards an infinite value. This can occur when the graph is a function of two or more variables, and the asymptote is the line at which the graph tends towards infinity. As the graph approaches the asymptote, it will either increase or decrease in value. The hole in the asymptote is the point where the graph does not pass through and instead deviates from the asymptote and goes towards infinity. This is often seen when the graph is a graph of a rational function, where the asymptote is formed by the denominator of the function. A hole in the graph asymptote can also be caused by the fact that the graph is not continuous, or by the presence of multiple asymptotes. In this case, the hole is formed by the intersection of the two asymptotes.

Learn more about graph here

https://brainly.com/question/17267403

#SPJ4

Graph this line using the slope and y-intercept: y= – 7x–3 Click to select points on the graph.

Answers

The slope of the line is -7 and the y-intercept is negative 3. The line is drawn below.

How to draw the graph of the function?

The collection includes all locations on the surface of the shape (x, f(x)) that make up a function of f's graph. We may alternatively say that the graph of f is the curve of y = f. (x). As a result, the diagram of an equation is a particular instance of the graphs of functions.

A connection between a number of variables results in a linear model when a graph is displayed. The variable will have a degree of one.

The linear equation is given as,

y = mx + c

Where m is the slope of the line and c is the y-intercept of the line.

The equation is given below.

y = -7x - 3

More about the graph of the function link is given below.

https://brainly.com/question/27757761

#SPJ1

In the figure, x∥y and a is a transversal that crosses the parallel lines.

Which angle pair forms alternate interior angles?
Responses

∠3 and ∠7
angle 3, and , angle 7

∠1 and ∠8
angle 1, and , angle 8

∠4 and ∠6

Answers

The angle pair that forms alternate interior angles are: C. ∠4 and ∠6.

What are Alternate Interior Angles?

Alternate interior angles are angles that lie on alternate sides of a transversal but on different parallel lines. They are also congruent angles.

In the figure given, lines x and y are parallel to each other, and are crossed by the transversal a.

Angle 4 and 6 lie on each of the parallel lines but on alternate sides of the transversal a.

Also, angle 3 and angle 5 lie on lines x and y that are parallel which is intersected by line a.

Angles 3 and 5, and angles 4 and 6 are both pairs of alternate interior angles.

Therefore, the answer is: C. ∠4 and ∠6.

Learn more about the alternate interior angles on:

https://brainly.com/question/24839702

#SPJ1

What are the roots of 3x² 14x 5 0?

Answers

The roots of the quadratic equation 3x²-14x-5 = 0 are 5, -1/3

What is a quadratic equation?

The meaning of quadratic equation is any equation containing one term in which the unknown is squared and no term in which it is raised to a higher power.

Given that, a quadratic equation, 3x²-14x-5 = 0

On factorizing, we get,

3x²-14x-5 = 0

3x(x-5)+1(x-5) = 0

(3x+1)(x-5) = 0

(x-5) = 0

x = 5

And,

(3x+1) = 0

x = -1/3

Hence, The roots of the quadratic equation 3x²-14x-5 = 0 are 5, -1/3

For more references on quadratic equation, click;

https://brainly.com/question/17177510

#SPJ4

An inground sprinkler nozzle sprays water onto the grass in the shape of a circle, with the nozzle at the center of the circle. On a coordinate plane, the nozzle is located at (0, 10) and the points (0, 25) and (0, −5) lie on the circle. Which equation represents the boundary that the sprinkler covers? (2 points) a (x − 10) 2 + y 2 = 225 b (x − 10) 2 + y 2 = 625 c x 2 + ( y − 10) 2 = 225 d x 2 + ( y − 10) 2 = 625

Answers

According to the given information [tex]C\left(x^2+(y-10)^2=225\right.\\[/tex] is the sprinkler's covered boundary is represented by equation.

The appearance of coordinate planes.

The reference system is a two-dimensional surface created by combining two number lines. A single beam number line makes up the x-axis. The title of the vertically x axis, which is the other figure line, is the y-axis. The intersection of the two axes is the origin. To chart lines, arrows, and other objects, utilize the coordinate plane.

What is the location of the coordinate plane?

The convergence of the x-axis, a horizontally number line, and the y-axis, a horizontal figure line, creates a coordinate plane. The origin of something like the coordinate plane is the vertical intersection of a three axes (plural for axis).

Briefing:

[tex]\begin{aligned}& (x+k_1)^2+\left(y+k_2\right)^2=h \\& (0,10) . \quad k_1=0, \quad k_2=-10 \\& x^2+(y-10)^2=h \\& \text { to, } 25, \quad(0,-5) \\&\Rightarrow h=225 \quad \\& x^2+(y-10)^2=225\end{aligned}[/tex]

Hence, the equation is [tex]C\left(x^2+(y-10)^2=225\right.\\[/tex].

To know more about coordinate plane visit:

https://brainly.com/question/13611766

#SPJ1

Is 2 a zero of the polynomial x³ 4x² 3x?

Answers

Yes, two is the zero of the given polynomial  x³+ 4x²- 3x - 18 is the true statement.

As given in the question,

Given polynomial is equal to :

x³+ 4x²- 3x - 18

Check whether two is the zero of the given polynomial  x³+ 4x²- 3x - 18 we have,

let f(x) =  x³+ 4x²- 3x - 18

If f(2) = 0 then 2 is the zero of the given polynomial.

Substitute the value of x = 2 in f(x) we get,

f(2) = 2³ + 4(2)² -3(2) -18

⇒ f(2) = 8 + 16 - 6 -18

⇒ f(2) = 24 - 6 - 18

⇒ f(2) = 18 - 18

⇒f(2) = 0

Therefore, the two is the zero of the given polynomial  x³+ 4x²- 3x - 18 is the true statement.

The above question is incomplete , the complete question is:

Is 2 a zero of the polynomial x³+ 4x²- 3x - 18 ?

Learn more about polynomial here

brainly.com/question/11536910

#SPJ4

There are 8 ounce in 1 cup, 4 cup in 1 quart and 4 quart in 1 gallon, which expreion how how to find the number of ounce in 1 gallon

Answers

In 1 gallon contains 768 ounces.

In the given, 1 cup = 8 ounce

4 cups = 1 quart

4 quart = 1 gallon

We can see that, 1 gallon is 4 quarts,

So, 6 gallon = 6×4= 24 quarts

Also 1 quart is 4 cups

So, 24 quarts =24×4=96 cups

1 cup is 8 ounce

So, 96 cups = 96×8=768 ounces

Therefore, 768 ounce in 1 gallon.

For such more questions about mathematical operations:

https://brainly.com/question/18018398

#SPJ4

There will be 128 ounce in 1 gallon.

given values in the question:

 1 gallon = 4 quarts

 1 quarts = 4 cups  

 so we have 16 cups in 1 gallon .

next we are given in the question that:

  1  cup = 8 ounce

and in 1 gallon we have 16 cups .

and we have to find number of ounce 1 gallon have , number of ounce have direct relation with number of cups.

so in 1 gallon , we have 16* value of 1 cup in ounce

hence value of 1 gallon = 16 * 8 ounce

=> 1 gallon = 128 ounce

To know more about ounce click on below link:

https://brainly.com/question/26950819#

#SPJ4

What does it mean when two such lines intersect? What can you say about the solution of the two equations? the graphs of x + 2y = 4 and y = 2x - 3

Answers

The intersection of the two lines represent the solution of the system of equations.

Hence the intersection of the two lines in this problem has the coordinates given as follows:

(2,1).

How to solve the system of equations?

The definition of the system of equations in this problem is given as follows:

x + 2y = 4.y = 2x - 3.

Replacing the second equation into the first, the variable x is obtained as follows:

x + 2(2x - 3) = 4

x + 4x - 6 = 4

5x = 10

x = 2.

Then, replacing x = 2 into the second equation, the variable y is given as follows:

y = 2(2) - 3 = 1.

The solution means that the linear functions x + 2y = 4 and y = 2x - 3 intersect at the coordinates (2,1).

More can be learned about a system of equations at https://brainly.com/question/24342899

#SPJ1

2 (r+3)
and please tell me how to do this question with a slow explanation pls so I can do it myself!! 20+ reward

Answers

Answer:

distribute

2 and r  ; 2 and + 3

2 * r = 2r

2 * 3 = 6

combine:

2r + 6

Step-by-step explanation:

heart and star pls <3 brainliest will be appreciated <3(っ◔◡◔)っ  -{ elyna s }-

Step-by-step explanation:

2 (r+3)

You are asked to multiply 2 by (r + 3).

To remove the ()'s, you must multiply 2 by both terms within the ()'s:

2(r + 3)

= 2 * r + 2 * 3

= 2r + 6

Please comment below if you have further questions for this problem.

a vairable x is normally distribtuted in a population with mean u and standard deviation rho. the standard error of the mean of a simple random sample of size 100 chosen fronm the population is 13.941. compute the population stadard deviation. give your answer precise to two decimal places

Answers

Therefore, the solution to this given problem is the standard deviation comes out to be 139.41 .

What does standard deviation mean and how is it used?

A measure of how far measurements for a group deviate from the mean is called standard deviation (mean or expected value). A low standard deviation indicates that most of the numbers are within a few standard deviations of the average, whereas a large standard deviation indicates that the numbers are more dispersed.

Here,

Given:

sample size(n) =100

SE =13.941

Since we are aware, the standard error of the mean

=> SE = [tex]\frac{\alpha }{\sqrt{n} }[/tex]

So α = SE * [tex]\sqrt{n}[/tex] = 13.941 * 10 = 139.41

Therefore, the standard deviation comes out to be 139.41 .

To know more about standard deviation , visit

https://brainly.com/question/23907081

#SPJ4

What is a vertical asymptote example?

Answers

A vertical asymptote example is a graph that shows an equation such as 1/x approaching infinity as x approaches 0. In this example, x = 0 is the vertical asymptote.

A vertical asymptote is a line on a graph that represents the point at which a function approaches infinity or negative infinity. In other words, it is the point at which the graph of the function becomes infinitely steep. An example of a vertical asymptote is the equation 1/x. As x approaches 0, the value of 1/x approaches infinity. This is represented on the graph of the equation as a vertical line at x = 0. This line is the vertical asymptote. A vertical asymptote indicates that the domain of the function does not include the point at which the asymptote occurs. This is because a function cannot approach infinity. Thus, the equation 1/x is not defined at x = 0.

Learn more about graph here

https://brainly.com/question/17267403

#SPJ4

really struggling on this & i need someone to help me

Answers

Answer:

[tex]x^3+x^2-5x+5-\frac{30}{x+5}[/tex]

Step-by-step explanation:

[tex]\frac{x^4 + 6x^3 -20x-5}{x+5} \\ \\ =\frac{x^3(x+5)+x^3-20x-5}{x+5} \\ \\ =\frac{x^3(x+5)+x^2(x+5)-5x^2-20x-5}{x+5} \\ \\ =\frac{x^3(x+5)+x^2(x+5)-5x(x+5)+5x-5}{x+5} \\ \\ =\frac{x^3(x+5)+x^2(x+5)-5x(x+5)+5(x+5)-30}{x+5} \\ \\ =x^3+x^2-5x+5-\frac{30}{x+5}[/tex]

What property is illustrated in if ∠ A ≅ ∠ B ∠ B ≅ ∠ C then ∠ A ≅ ∠ C?

Answers

The property of congruence illustrated in the statement is the transitive property.

The transitive property states that if A is congruent to B and B is congruent to C, then A is congruent to C. In other words, if two things are congruent to a third thing, they are also congruent to each other.

In the statement "If AB ≅ DE, EF ≅ DE then AB ≅ EF," AB is congruent to DE, and EF is congruent to DE, so AB must also be congruent to EF according to the transitive property.

The other properties you listed are not applicable in this case. The symmetric property states that if A is congruent to B, then B is congruent to A. The reflexive property states that every object is congruent to itself. And multiplication is not a property of congruence.

Learn more about the property of congruence at

https://brainly.com/question/2039214?referrer=searchResults

#SPJ4

The question is -

What property of congruence is illustrated in the statement? If AB ≅ DE, EF ≅ DE then AB ≅ EF.

a. Symmetric

c. Reflexive

b. Transitive

d. Multiplication

Find the angle of elevation of the sun if a building 135 feet tall casts a shadow 150 feet long. Round to the nearest degree

Answers

The angle of elevation of the sun if a building of 135 feet tall cast a shadow  is 42°.

What is angle of elevation?

The angle of elevation is an angle that is formed between the horizontal line and the line of sight.

To calculate the angle of elevation, we use the formula below.

Formula:

∅ = tan⁻¹(h/d)................... Equation 1

Where:

∅ = Angle of elevation of the sunh = Height of the buildingd = Length of the shadow

From the question,

Given:

h = 135 feetd = 150 feet

Substitute these values into equation 1

∅ = tan⁻¹(135/150)∅ = tan⁻¹(0.9)∅ = 41.99°∅ ≈ 42°

Hence, the angle of elevation of the sun is 42°.

Learn more about angle of elevation here: https://brainly.com/question/27243378

#SPJ1

What are the five types of domain?

Answers

Domains having continuous boundaries, Lipschitz boundaries and C1 boundaries are three types of domain.

Define domain.

The collection of all potential inputs for a function is its domain. For instance, the domain of f(x)=x^2 and g(x)=1/x are all real integers with the exception of x=0. Additionally, we can define special functions with more constrained domains.

How to find domain?

Consider the function y = f(x), which has the independent variable x and the dependent variable y. A value for x is said to be in the domain of a function f if it successfully allows the production of a single value y using another value for x.

There are three types of domain in mathematics. Domains having continuous boundaries, Lipschitz boundaries, C1 boundaries, and others are frequently thought of as types of domains. An exterior or external domain is the interior of a bounded domain's complement, whereas a bounded domain is a domain that is a bounded set.

To learn more about domain visit the link:

https://brainly.com/question/26098895

#SPJ4

Solve. 5x – 10 ≤ 20
a. –[infinity], 2]
b. –[infinity], 2)
c. –[infinity], 6]
d. –[infinity], 6)

Answers

The equation does not include the value of 6, we can also express the solution as –[infinity], 6), which excludes the value of 6

The equation 5x - 10 ≤ 20 can be solved by isolating the x variable and rearranging the equation to solve for x. First, we need to add 10 to both sides of the equation in order to get all the terms on one side of the equation. This gives us 5x ≤ 30. Then, we need to divide both sides of the equation by 5 in order to isolate the x variable. This results in x ≤ 6. The solution for this equation can be written as the set of all real numbers less than or equal to 6, which can be represented as –[infinity], 6]. Since this equation does not include the value of 6, we can also express the solution as –[infinity], 6), which excludes the value of 6.

In more detail, when solving a linear inequality, the objective is to isolate the variable on one side of the inequality sign. The first step is to move all terms not containing the variable to the other side of the inequality sign by performing the opposite operation of the given equation. In this case, the equation 5x - 10 ≤ 20 has a subtraction on the left-hand side, so the opposite operation is to add 10 to both sides of the equation. This results in 5x ≤ 30.

Next, we need to divide both sides of the equation by 5 to isolate the x variable. This yields x ≤ 6. The solution for this equation is the set of all real numbers that are less than or equal to 6, which can be written as –[infinity], 6]. Since the equation does not include the value of 6, we can also express the solution as –[infinity], 6), which excludes the value of 6.

Learn more about Real numbers here :

https://brainly.com/question/10547079

#SPJ4

Solve 4x4 + 7x2 – 2 = 0. Choose the factored form of the polynomial expression. Select all of the solutions to the equation.

Answers

The solutions to the equation are x = ±1/2 and x = √-2 and the factored form is (4x² - 1)(x² + 2) = 0

How to determine the solution to the equation?

From the question, we have the following parameters that can be used in our computation:

4x4 + 7x2 – 2 = 0

Rewrite the equation properly

So, we have the following representation

4x⁴ + 7x² – 2 = 0

Expand the equation

This gives

4x⁴ + 8x² - x² – 2 = 0

Factorize the expanded equation

So, we have

4x²(x² + 2) - 1(x² + 2) = 0

Factor out x² + 2

So, we have the following representation

(4x² - 1)(x² + 2) = 0

When the equation is solved, we have

x = ±1/2 and x = √-2

Read more about polynomial equations at

https://brainly.com/question/17517586

#SPJ1

What are the 3 properties of a right triangle?

Answers

90 degrees or a straight angle is always one angle. The hypotenuse is the side that has an angle of 90° on it. Always, the hypotenuse is the longest side. The remaining two inner angles add up to a total of 90°.

what is a right angle?

Right angles are created when two straight lines cross at a 90° angle or are perpendicular to one another at the intersection.

An angle having a value of 90° is considered to be a right angle. Right angles are created when two rays cross one other and angle 90 degrees at the intersection. The screen of a mobile phone, the borders of a cabinet, and other places are only a few examples of where we might see it.

90 degrees or a straight angle is always one angle. The hypotenuse is the side that has an angle of 90° on it. Always, the hypotenuse is the longest side. The remaining two inner angles add up to a total of 90°.

To know more about right angle visit:-

https://brainly.com/question/7116550

#SPJ4

What is the x-coordinate of the relative maximum of f(x) = x3 + 4x2 - 3x + 1?

Answers

Answer:

  x = -3

Step-by-step explanation:

You want the x-coordinate of the relative maximum of f(x) = x³ +4x² -3x +1.

Extrema

The x-coordinates of the relative extrema of the function will be those values of x where the derivative of the function is zero.

  f'(x) = 3x² +8x -3 = (x +3)(3x -1)

The derivative is zero where its factors are zero, at x = -3 and x = 1/3.

Relative maximum

The leading coefficient of this cubic is positive, so the function values generally increase from left to right. That means the relative maximum will have the lowest x-coordinate: x = -3

The x-coordinate of the relative maximum is -3.

When bisecting segments and angles, which step is the same?

Draw a ray with one endpoint.

Mark the intersection points of the arcs.

Draw a ray from the vertex to another point.

Place the compass on the endpoint of the segment.

Answers

The step that is the same when bisecting segments and angles is "Draw a ray from the vertex to another point."

When bisecting a segment, you must draw a line that divides the segment into two equal parts. One way to do this is to draw a ray with one endpoint at the midpoint of the segment and the other endpoint at any point beyond the segment. This ray will bisect the segment. When bisecting an angle, you must draw a line that divides the angle into two equal angles. One way to do this is to draw a ray from the vertex of the angle to any point on the angle. This ray will bisect the angle.

Learn more about Segments here:

https://brainly.com/question/28554913

#SPJ4

Answer: Mark the intersection points of the arcs.

Step-by-step explanation: Draw a ray with one endpoint. is incorrect

Does SAS prove congruence or similarity?

Answers

Answer:

SAS proves congruence.

Step-by-step explanation:

What is SAS?

SAS is a triangle congruence statement to say that 2 triangles are congruent.

How do we determine if 2 triangles are congruent by SAS?

The 2 triangles' corresponding sides are congruentThe 2 triangles' corresponding, congruent sides have an included corresponding angle

Example (figures not drawn to scale):

In the figure below, ⎯⎯⎯⎯⎯⎯⎯⎯,⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯,
B
L
¯
,
A
M
¯
,
and ⎯⎯⎯⎯⎯⎯⎯⎯⎯
C
K
¯
are medians of △

A
B
C
. If AM = 21 and LO = 4, then AO =

Answers

Answer:

AO = 14

Step-by-step explanation:

The figure we are given shows the intersection of the medians of this triangle. In fact, the point of intersection of the medians is called the centroid. In this problem, O is the centroid.

The intersection of the medians of a triangle has some properties:

(1) The distance from a vertex of the triangle to the centroid is 2/3 of the distance from said vertex to the opposite side of the vertex

(2) The distance from the centroid to a side opposite of a vertex is 1/3 of the distance from said vertex to the opposite side of said vertex

(3) The longer part of the median partitioned by the centroid is twice the distance of the shorter part of said median partitioned by the centroid

We can use the first property stated to find the distance of AO.

[tex]AO = \frac{2}{3} AM[/tex]

We are given that AM = 21

[tex]AO = \frac{2}{3}(21)[/tex]

[tex]AO = \frac{42}{3}[/tex]

[tex]AO = 14[/tex]

What congruent means in math?

Answers

Answer:

Answer below

Step-by-step explanation:

The meaning of congruence in Maths is when two figures are similar to each other based on their shape and size.

Answer:exactly equal shape and size

Step-by-step explanation:

Esther and Michael planted a rose in their garden. Esther's rose is x cm tall after 3 weeks. Mike's rose is three less than twice the height of Esther. the sum of their heights decreased by 5 is 22. find the heights of the roses.
HELPPPPPPPP PLEASEEEEEEEEE

Answers

The height of the rose of Esther's rose is 10 cm while Mikes's rose is 17 cm.

How to form an equation?

Determine the known quantities and designate the unknown quantity as a variable while trying to set up or construct a linear equation to fit a real-world application.

As per the given,

Height of Esther's rose = x cm

Height of Mike's rose = 2x - 3

The sum of their heights decreased by 5 is 22.

x + 2x - 3 - 5 = 22

3x - 8 = 22

x = 10

Thus, Esther's rose = 10 cm and Mike's rose = 2 x 10 - 3 = 17 cm

Hence "Mike's rose is 17 cm tall, compared to Esther's 10 cm high rose".

For more about the equation,

https://brainly.com/question/10413253

#SPJ1

How do you tell if the leading coefficient of a polynomial graph is positive or negative?

Answers

By observing the concave nature of the polynomial graph , We can tell the leading coefficient is positive or negative .

What do you mean by a polynomial?

Sums of terms with the form  kxⁿ, where K is any number and N is a positive integer, are known as polynomials.

What do you mean by leading coefficient?

The term with the greatest x power is the leading term in a polynomial function. The leading coefficient is the coefficient of the leading phrase.

If the polynomial graph is concave downwards, The leading coefficient is negative.

If the polynomial graph is concave upwards, The leading coefficient is positive.

To learn more about polynomials visit:

https://brainly.com/question/11536910

#SPJ4

How do you write 10 more than a number?

Answers

The algebraic expression for 10 more than a number is x + 10 or 10 + x.

The x in the expression is called a variable, which can be represented by any letter in the alphabet.

An algebraic expression is a mathematical expression that consists of numbers, variables and operators, and its value can change.

Some basic mathematical operators are +, -, x and /.

The given phrase states that a result can be obtained by adding 10 more to the variable.

The variable x can be replaced by any number.

If x equals 2, then the expression x + 10 has a value of 12.

To know more about algebraic expression visit brainly.com/question/953809

#SPJ4

What is domain and range examples?

Answers

Let us take f(x)=x^2 to define the domain and range of a function.

Define range.

The set of all values that the function might return when the domain is provided as input is the definition of range.

How range is used in daily life?

In real life, range is employed to perform mathematical computations. Range can be used to determine how much time has elapsed, just like when determining your age. You were born in 2005, which makes the current year 2020. What age are you?

The collection of all potential inputs for a function is its domain. For instance, the domain of f(x)=x^2 and g(x)=1/x are all real integers with the exception of x=0.

The collection of potential output values for a function is known as its range. For instance, the range is the non-negative real numbers for the function f(x)=x^2 on the domain of all real numbers (x∈R), which may be represented as f(x)0 (or [0,∞] using interval notation).

To learn more about range visit the link:

https://brainly.com/question/2264373

#SPJ4

Do you get back pay for limited capability for work?

Answers

You may get back payment for limited capability for work.

In the event that you receive Universal Credit, the decision-maker will affix a letter indicating whether you passed the assessment to your journal. Whether or not you pass, you can still receive Universal Credit. If you don't succeed, though, you might have to start seeking employment.

If you did well on the test, the letter will state which group you were assigned to. In most cases, you will get additional funds for your Universal Credit claim if you have been assigned to the Limited Capability for Work Related Activity (LCWRA) category. Additionally, you might get some back pay.

To learn more about work here:

https://brainly.com/question/26385716

#SPJ4

what is the answer of this?

Answers

Answer:

60

Step-by-step explanation:

One way to do this is to take your total volume ([tex]120cm^{3}[/tex]) and divide that by the volume of each cube ([tex]2cm^{}[/tex]).

120 ÷ 2 = 60

The chef can make 60 cubes.

Let's check our work.

To check our work, we can take the volume of each cube, and multiply that by the number of cubes.

2 × 60 = 120

Therefore, the chef can produce 60 cubed watermelons.

Other Questions
Oxalic Acid, a compound found in plants and vegetables such as rhubarb, has a mass percent composition of 26.7% C, 2.24% H, and 71.1% O. Oxalic acid can interfere with respiration and cause kidney or bladder stones. If a large quantity of rhubarb leaves is ingested, the oxalic acid can be toxic. The lethal dose (LD50) in rats for oxalic acid is 375 mg/kg. Rhubarb leaves contain about 0.5% by mass of oxalic acid. (Show your work, using the insert equation tool :) What is the empirical formula of oxalic acid PLEASEPLEASE ANSWER and if i get any more bots answering with links im gonna cry ive put this question 5 times Study the image, and then choose the statement that best describes the image. OohBalloons are deflatin'Guess they look lifeless like meWe miss you on your side of the bed, mmmStill got your things hereAnd they stare at me like souvenirsDon't wanna let you out my headJust like the day that I met youThe day I thought foreverSaid that you love me But that'll last for neverIt's cold outsideLike when you walked out my lifeWhy you walked out my life?I get like this every timeOn these days that feel like you and meHeartbreak anniversary'Cause I remember every timeOn these days that feel like you and meHeartbreak anniversaryDo you ever think of me? If the driver slammed on the brakes, what could happen to the crate? If aluminum nitrate reacts with calcium phosphite, what is the balanced coefficient of aluminum nitrate? how do child laborers compare to child slaves from chocotate from children Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number.