In the first paragraph of Ch. 1 in to kill a mockingbird, an event is foreshadowed. What is it?

Answers

Answer 1

Answer:

im not sure

Explanation:


Related Questions

Which word best describes andrey

Answers

Answer:

Please provide more context

Explanation:

Answer:

Do you mean "Andrey in The Three Sisters"?

He's a solitary guy, usually coming and going through the large group scenes. Solitary: done or existing alone.

What strategy does Florence Wilmington use to connect the audience with the performance of Marian Anderson at the Metropolitan Opera House in 1955?

Answers

This question is about the article "A night to remember"

Answer:

She uses suspense, related to Marian's age and her ability to achieve correct and difficult to achieve grades.

Explanation:

The article was written to show how Marian Anderson was a sensational singer, capable of conveying a strong emotion to the point of moving the audience through her vocal skills.

The author of the article shows how, over time, Marian's artistic abilities were questioned, as many people were not convinced that she was capable of doing the same things, but even older Marian managed to make a presentation as exciting as before, taking the public to admire it so fervently.


What can the reader infer about the impact of the partnership between Matthew Boulton and James Watt on the
development of the steam engine?
A. Matthew Boulton's partnership with James Watt provided the financial capital for the development of a
steam engine
B
Their partnership allowed James Watt to develop a steam engine capable of driving passengers along a
road at 15 miles per hour
Their partnership allowed James Watt to convert a small steam pump into a steam engine used for organ
blowing and turning spits
D. James Watt's partnership with Matthew Boulton provided the inventiveness for the development of more
efficient methods of mining

Answers

Matthew Boulton and James Watt developed the steam engine. It can be inferred that the financial support for the development of a steam engine came from Matthew Boulton's relationship with James Watt. Thus, option A is correct.

What is an inference?

An inference is a conclusion and deduction that can be reached from the information and the evidence presented in the text. It can be based on logical assumptions and can be deductive and inductive.

From the development of the steam engine, it can be inferred that the discovery was successful due to the capital partnership between Matthew Boulton and James Watt. It can be deduced that Matthew Boulton invested and supported in Watt's engine development and introduced it to the market.

Therefore, option A. the financial relation between Watt and Boulton can be deduced.

Learn more about inference here:

https://brainly.com/question/1935977

#SPJ5

Think of some examples of informal writing or a conversation you can recall well. Describe how clearly they express a unified point of view, tone, and purpose. Compare them to at least one formal informational text. Discuss why you think the two modes of communicating are different or the same.

Answers

Answer:

Communication skills, including writing, are some of the most important soft skills (employable skills that have more to do with emotional IQ such as common sense, communication, problem-solving, and collaboration) that students learn when they are in college because most professions require high competency in written communication, which can be a chance for one to shine or to falter. With emails, memos, letters, texts, and even Tweets, most people spend a fair amount of time at work communicating via the written word. Whether you are messaging a colleague, writing to your manager, creating the company newsletter, or writing a press release to the media, your writing skills can boost or hinder your career easily, even if you do not have a “writing” profession. Basically, writing skills make a difference in how you are perceived in college and in the workplace.

Explanation:

According to the article "How Did World War II Begin," what was one of Hitler's
first political actions?
A. He started censoring the information printed in newspapers.
B. He allowed women to become part of the Nazi military.
o
C. He removed peoples' ability to access radio broadcasts.
D. He encouraged other countries to investigate his military services.
SUBMIT

Answers

The answer is A . He started censoring the information printed in newspapers

what would you call chapter 8 and chapter 9 of the outsiders

Answers

climax leading up to Johnny’s deaths and eventually reaching it includes “Stay gold, stay gold Ponyboy”

One of your aunts was out of the country while you were attending a wedding ceremony of your cousin. Now that she is back, she has requested you to write her a detailed letter telling her all about the grand wedding. who was the relative and when and where did the weddibg take place customs, dresses , food wedding halls along with the decorations and music how it all went and how much you missed your aunt Cover all the points in detail.

Answers

Dear Aunt.

I am writing this letter to tell you about the wedding that you cannot attend. She was missed by everyone, mainly by me, who was looking forward to seeing her again and enjoying the party with a company as pleasant as you.

About the wedding, everything could not be more perfect than it was. The ceremony was held in the cathedral of the city center, which was elegantly decorated with flowers of light tones and modern lights that gave an air of refinement to the party. The bride, was wearing a beautiful dress, obviously white, with a row of delicate buttons on the back and a tail of the kind that was not too long. She did not wear a veil, but her hair was tied in a very well done banana bun.

The groom was gorgeous, with a light colored suit, which I thought he valued a lot in the photos, as both were in the same color palette.

The ceremony lasted about an hour and a half, as the bride delayed minutes.

After the ceremony, we proceed to the reception, which was held in a very beautiful resort hotel that is east of the cathedral. The decor was beautiful, with fewer flowers this time, but very well lit. As the wedding was made during the day the food was something very light and simple, basically consisting of a table of sweets and a table of cold cuts that are very tasty.

The DJ invited to the party played the most popular songs at the moment and the bride and groom danced the ditch and a remixed version of "Te time of my live", which was really fun.

In the end all the women will get together to pick up the bouquet and a friend of the bride was the lucky one who got it.

I went home before the party was over, as I had to work the next day, but I loved every minute I spent there.

I hope that soon we have another wedding and that you can attend, because I miss you.

Affectionately.

MJ.

One of my friends plan to see that movie this weekend.
Which answer option best revises this sentence to use correct subject-verb agreement?


A.
Change "One of my friends" to "My friend."

B.
Change "this weekend" to "on Saturday."

C.
Change "plan" to "plans."

D.
Change "to see" to "sees."

Answers

Answer:

I beleive it is c sorry if i am wrong -Lucy

Explanation:

Answer: c

Explanation:

Education empowers a person elaborate this statement​

Answers

Answer:

Education empowers people with the knowledge, skills and values they need to build a better world. ... The belief that quality education can help reduce poverty and inequality comes from a recognition that education is a basic human right—similar to food and shelter—and that it is vital to protecting human dignity.

Explanation: hope this helps!

choose 6 words that would describe the setting typhoid mary found herself in while she was in isolation​

Answers

Answer:

Explanation:yphoid Mary probably wouldn't have shared my concerns. Mary did not wash her hands. As an asymptomatic carrier of potentially fatal Salmonella typhi, she ... I can relate with her need to earn a living, to make a choice about ... Her ruse was discovered in 1910 and she was forced into quarantine isolation

Think of the last time you found yourself feeling impatient. What was causing the delay? How did you react? Were you able to calm yourself down and accept the delay?

Answers

I have bad anxiety and ADD so I’m very impatient all the time and then if I have to wait I get very stressed. I usually calm my self down by calling my therapist

Read the following introduction for a research paper on novels and answer the question.

The word novel is borrowed from the Italian word novella (Henry 235). Defining exactly what a novel is can be hard work. The standard dictionary definition is "a fictional prose narrative of considerable length, typically having a plot that is unfolded by the actions, speech, and thoughts of the characters" ("Novel"). Novels in some way represent life. The representations, however, occur in a narrative about life and experience. Since the novel can represent life, such fiction can be serious. The seriousness begins when the novel deals with humankind in a way that shows its importance and significance within the fictional world of the novel. The world of a novel varies greatly from author to author because each writer creates a new fictional world for a new work. That world may be all the relationships of a whole nation or of a very small town. That world may be as confined as the captain's cabin on a ship or as open as a little island. That world may also be as withdrawn as the farthest recesses of the human mind. Novels are important as they entertain and instruct the readers through a variety of life experiences.

What is the author's tone toward the subject?

It is mocking.
It is detached.
It is interested.
It is frustrated.

Answers

It is interested. The third option

What connection does President Kennedy make between past attempts at a space race and the attempts he wished to make in 1961?

Answers

Answer:

On May 25, 1961, he stood before Congress to deliver a special message on "urgent national needs." He asked for an additional $7 billion to $9 billion over the next five years for the space program, proclaiming that "this nation should commit itself to achieving the goal, before the decade is out, of landing a man on ...

hope this helps..   :)

fill in the blank appropriately. when a rocket lifts off there ______ with an equal and opposite ________. 1. push, pull 2. an action, reaction.​

Answers

Answer:

2 i believe

Explanation:

Who are the main characters and what is the setting of the movie you just watched?

Answers

Answer: the movie i watched is frozen and the charcter are elsa and anna.

Explanation:

Answer:

Main character: Lucy, John, Maria, and Sade

Setting: on a farm out in the country

Explanation:

what is the effect of density on rocks?

Answers

Answer:

density is defined as the mass of a substance per unit volume, and is highly variable in crustal rocks. Rock density is a physical characteristic that is governed by the chemical composition (in situ minerals) and pore spaces of a specific rock or rock type.

Explanation:


You can use your sense of sight, sound, touch, taste, and smell to add_____to
your writing
A. sensory images
B. analogies
C. explanations
D. quotations

Answers

Answer:

sensory images

Explanation:

Sensory images

because Sensory images explores the five human senses: sight, sound, taste, touch, and smell. It makes a passage or scene come alive.

Writing a screenplay in Monster gives Steve Harmon a more accurate view of his situation because it

forces him to think about the movements, personalities, and viewpoints of the people around him.
allows him to have access to the judge's documents and notes.
gives him more time to accept the situation and come up with a plan for living his life in prison.
offers him a better understanding of the law and defense techniques.

Answers

Answer:

A.forces him to think about the movements, personalities, and viewpoints of the people around him.

Explanation:

On edge, I took the quiz and the unit test , A was right. or at least that Line of words was right.

The screenplay represents his "true" self's dissociation from the accused criminal on trial. The postings show Steve's views as a man trying to reconcile his belief inside his guilt with such a legal system that looks to be prejudiced towards him.

Devils pursue and feed on the helpless, which is why they're being imprisoned. Symbolically, "monsters" are an unfair moniker used to misunderstand young minorities who are presumed to be guilty before being tried.Composing a script on Monster gives Steve Harmon a more accurate picture of his circumstances. Since it pushes him to analyze the motions, emotions, and perspectives of others around him.

Therefore, the final answer is "first choice".

Learn more:

brainly.com/question/4538426

What does the number of zooplankton in the Hudson River show about the large zebra mussels in the river? Use evidence from the text to support your answer.

Answers

Answer:

“Based on previous studies, scientists estimated how much plankton the zebra mussels could filter out of the water. (Phytoplankton and zooplankton are microscopic organisms that are two critical components of the river's food web.) The numbers suggested the impact of zebra mussels on the river could be huge.”

Explanation:

idk if this is write bc I don't have the text

Answer:

Since large zebra mussels tend to feast on zooplankton, the increase of zooplankton can spread the concern of the large zebra mussels' population.

Text evidence (Paragraph 3):  If there were fewer large zebra mussels, it made sense that there was more zooplankton. That's because large zebra mussels feed on bigger food particles like zooplankton. Smaller zebra mussels can only eat smaller particles like phytoplankton and bacteria.

Why did romanticism appear?

Answers

Answer:

Romanticism was a revolt against the aristocratic social and political norms of the Age of Enlightenment and also a reaction against the scientific rationalization of nature.Explanation:

hathorne states, "At every execution I have seen naught but high satisfaction in the town." Do you believe it and why?

Answers

Answer:

Meh

Explanation:

Which of the following is a simple sentence

Answers

Answer:c

Explanation:

With spring turning to summer, the rift between the twelve- and thirteen-year-olds grew worse. What if by September, when I was finally thirteen, they had fourteen-year-old clubs?

Using the words you highlighted, select the best definition for rift.

a season of the year
a break or split between two groups
a group of people who enjoy an activity

Answers

Answer:

a break or split between two groups

G R I N C H M O V I E

what are images i could draw for “how the grinch is a bad citizen”

GIVE 3 EXAMPLES PLS

Answers

Answer:

The grinch sneaking into chimneys (burglary)

The grinch stomping on presents (harm of property)

The grinch stealing presents (theft)

I hope that helped, please mark 5 stars and/or say thanks if so!

Stay hydrated

~Roi

Determine what is wrong with the Language in each message, and rewrite using more appropriate language

1. A memo to staff: “employees cannot take more than 45 minutes for lunch.”

2. A letter to an applicant: “We don’t think you are the best candidate for the job. We have selected someone else, but you can apply for other jobs.”

3. An email to a coworker: “I can’t finish that chart cuz I gotta leave early to go to the Dentist.”

Answers

Answer:

What do I know about the audience’s education, beliefs, culture, and attitude? ;How should I format this message? ; How much does the audience know about my topic?

Explanation:

Do I need to include more background information? Too much basic information evokes a generalized idea, which does not contribute to reaching the desired target audience.

What do I know about the audience’s education, beliefs, culture, and attitude? Asking yourself this type of question will undoubtedly contribute to a narrowing and targeting of the audience that the writer wants to reach.

How should I format this message? This question is essential, as it will provide very important support about the language that will be used. Remember that language is something that, being used well, helps a lot in identifying with the audience desired by the writer.

How much does the audience know about my topic? Another important question. With a correct answer or a writer will think how to convey a message, how to argue it.

Can I get someone else to transmit this message?  

The writer's concern is not based on the search for someone to transmit the message for him, but he must be guided in knowing how to transmit the message.

paragraph on human trafficking, has to be detailed and compelling on the issue not hyperbolic .

(please help i have another project to do and this is due in 30 min)

Answers

The world’s new modern day slavery. Something that rarely people come out of alive. Many don’t consider this a threat to there everyday life but for some it’s a major concern. Self defense classes are becoming the new normal.

I know it’s not much but adding details and working off that should help.

How is Mary Maloney able to create an alibi? Describe the steps she took to create an alibi that would hold up against the prying eyes of the investigators. Please respond in at least 2-3 questions.

Answers

Answer:yeesssssssssssssssss

Explanation:

What is a predicate in a sentence?

Answers

Answer:

the part of a sentence or clause containing a verb and stating something about the subject

Explanation:

looked it up in the dictionary

Answer:

the part of a sentence or clause containing a verb and stating something about the subject

Explanation:

John went home

Went home would be the predicate

Part A
Reread paragraphs 6-10. What does Gortsby think about the young man during this
conversation?
A He is careless.
B He is lying.
С He is confused.
D He is helpless

Answers

Answer:

B) he is lying

Explanation:

Answer:

D

Explanation:

In the text he text after the young man claims he might have to spend the night at the embankment Gortsby slowly says "Of course,", as if the young man is helpless. Hope this helps :D

To the nearest​ millimeter, a cell phone is 90 mm long and 44 mm wide. What is the ratio of the width to the​ length?

Answers

Answer:

the ratio of of a cell phone is 90 mm long and 44 wide is 92:44

Other Questions
a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives?