is it true that uranus was knocked over by a collision with a planet sized object

Answers

Answer 1

Answer:

It turns out that Uranus is so weird because of a massive collision billions of years ago. A new study confirms that this collision with a huge object which was approximately twice the size of Earth.  

Explanation:


Related Questions

If something's neural center dies, would you classify its cells as dead?

Answers

Answer:

No because only the neural organ died not the cells

No the cells are still living

So this is a simple yes or no question
In photosynthesis is the water broken down by hydrogen molecules yes or no

Answers

yes i think so, but not sure
Water splitting is the chemical reaction in which water is broken down into oxygen and hydrogen. It says it gets broken down into hydrogen so no i don’t think it is broken down BY hydrogen.

which of the following is not a fluid? air, water, carbon dioxide, or wood

Answers

Answer:

Wood

Explanation:

*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^

Wood is not a fluid. It is a solid.

*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^*^

#teamtrees #WAP (Water And Plant)

Answer:

wood

Explanation:

its common scene luv

Pea plant clones are given different amounts of water for a three-week period. First pea plant receives 400ml. Second pea plant receives 200ml. Third pea plant receives 100ml. Fourth pea plant does not receive any extra water; the plant only receives natural ways of receiving water. The height of the pea plants is recorded daily. What is the independent variable?


A) the different amounts of water

B) the heights of the pea plant

C) the pea plants

D) the natural ways of receiving water

Answers

Answer: The independent variable is the different amount of water. The correct option is A.

Explanation:

A variable can represent age, a person, or an entity that can be measured. In statistics, it is simply defined as an attribute of an object to be investigated. There are different types of variables these includes:

--> Dependent variable and

--> Independent variable.

Dependent variables are simply the variables that are affected by the changes that occurs in the experiment. From the experiment they should include:

--> the height of the plant,

--> the size of the plant,

--> the number of leaves

---> if the plant survived or not (dead).

Independent variable are the variables that are changed in the experiment. A good example from the pea plant experiment is WATER. It is the aspect that is used to alter the dependent variable which is the height of the pea plant. I hope this helps, thanks!

Which factor would have the greatest influence on the southern migration of animals living in the northern hemisphere

Answers

Answer:

Animal migration is the relatively long-distance movement of individual animals, usually on a seasonal basis. It is the most common form of migration in ecology. It is found in all major animal groups, including birds, mammals, fish, reptiles, Many of these migrations are north-south, with species feeding and breeding in.

How many more cherry pies have 60 to 89 cherries than 90 to 119 cherries?

Answers

Answer:

They are the same thing

6 pies are more in 60 to 89 cherries than 90 to 119 cherries, a bar graph is a graphical depiction of information, amounts, or numbers using bars or strips.

How to depict the bar graph?

They are employed to contrast and compare various data kinds, frequencies, or other measurements of several categories of data.

The calculation of the bar graph in the given question.

For 60 - 89 cherries there are 10 pies

For 90 -119 cherries there are 4 pies

10 -4 = 6  pies

The image for the graph is attached below.

When displaying sections of data, bar charts should be used. As long as there aren't too many categories to compare, vertical bar charts can be useful for comparing several categories or discrete data, such as age groups, classes, schools, etc. They are quite helpful for time series data as well.

Therefore, there are 6 more pies in the 60 -89 cherries category than in the 90-119 category.

Learn more about bar graphs, here:

https://brainly.com/question/13028521

#SPJ2

Which statement about sister chromatids is true? One sister chromatid is inherited from each parent. Sister chromatids are always in every cell. Sister chromatids are only present during cell reproduction. Each sister chromatid forms a lobe of a chromosome.

Answers

Answer:

One sister chromatid is inherited from each parent.

Explanation:

Answer:

its C

Explanation:

HELP!!!!!! FIRST PERSON TO ANSWER CORRECTLY GETS BRAINLIEST!

The movement of tectonic plates in two different locations is shown below:

Which statement is most likely true?

An earthquake may in occur in location a and subduction occurs in location b

Subduction occurs in both locations

Subduction occurs in location a and a volcanic eruption may occur in location b

Sea floor spreading occurs in both locations

Answers

Answer:

An earthquake may in occur in location a and subduction occurs in location b

The answer is c I hope this helps

Imagine you are a world famous primatologist, a scientist who studies primates. An
unidentified, complete fossil skeleton arrives at your lab. You suspect that it's a primate
fossil. What observations would you make to determine if your suspicions are accurate?

Answers

The first thing I would do is compare it to another primate skeleton and contrast the two skeletons. Next I would try to brainstorm whether or not it’s a cousin of let’s say an orangutan or gorilla.
(This is all I could come up with sorry)

A scientist presents the finding from her latest research at a scientific conference. Several scientists in the audience question her analysis. Which of the following is the best response to the criticism?






A) accept the criticism as fact and change the conclusions.

B) refused to speak for the remainder of the conference

C) assume that the criticism is inaccurate and ignore it

D) review the data analysis in light of the criticism

Answers

Answer: A

Explanation:

I think it’s D. She should review the data first.

jennifer performed an experiment to see how temperature affects the rate of breathing. group A will have their rate of breathing measured in 35 degrees Fahrenheit and group B will have their rate of breathing measured in 70 degrees Fahrenheit. write an "if..then" hypothesis statement ​

Answers

Answer:

If the temprature increases then the rate of breathing will decrease

Explanation:

This is because the increase in body temprature  increases the heart rate making it harder to breathe

How many neutrons does Phosphorus have? Use the diagram below to help find the amount:

Answers

Answer:

16

Explanation:

cellular activity across a cell membrane

Answers

Answer:

The plasma membrane is a selectively permeable barrier between the cell and the extracellular environment. Transport of such molecules and ions across all cellular membranes is mediated by transport proteins associated with the underlying bilayer.

Explanation:

What three basic things must the human population have in order to survive?
O A. Shelter, money, and waste disposal
O B. Food, shelter, and transport
O C. Food, shelter, and water
O D. Electricity, water, and farmland
Please help

Answers

Answer:

C is the correct answer

Answer:

Food, water and shelter are the three basic things the human population must have in order to survive.

Explanation:



The atomic number of carbon is six, which means that a carbon atom has six protons. Carbon has three

naturally occurring isotopes: carbon-12, carbon-13, and carbon-14. Which of these statements are true

about carbon and its isotopes? Select all that apply.

A. All carbon atoms have six neutrons.

B. All carbon atoms have six protons and six electrons.

?

C. Atoms of all carbon isotopes have either more than 6 electrons or fewer than 6 electrons.

D. Atoms of some naturally occurring carbon isotopes may have six neutrons.

E. Atoms of some naturally occurring carbon isotopes may have twelve neutrons.

Feed

Answers

Answer:

B. All carbon atoms have six protons and six electrons.

D. Atoms of some naturally occurring carbon isotopes may have six neutrons

Explanation:

Isotopes are atoms of the same elements having same atomic number but different atomic masses.

Atomic number is the number of protons (or electron number in neutral atoms) present in the atomic nucleus of the atom.

Atomic mass number is the sum of protons and neutrons present in the nucleus of the atom.

Considering the options above from the above definitions:

A. All carbon atoms have six neutrons is false because carbon-12, carbon-13 and carbon-14 has 6, 7 and 8 neutrons respectively.

B. All carbon atoms have six protons and six electrons is true because the atomic number of carbon is 12.

C. Atoms of all carbon isotopes have either more than 6 electrons or fewer than 6 electrons is false because atoms of all carbon isotopes have six electrons.

D. Atoms of some naturally occurring carbon isotopes may have six neutrons is true because atoms of carbon-12 have six neutrons.

E. Atoms of some naturally occurring carbon isotopes may have twelve neutrons is false because none of carbon-12, carbon-13 or carbon-14 have twelve neutrons.

Answer:

the answer is b and d

Explanation:


Which of the following statements best describes cellular respiration?

1.Sunlight and carbon dioxide are used to make ATP.
2.ATP and oxygen are used to make sugars and starches.
3.Glucose molecules from food and oxygen are used to make ATP.
4.ATP and carbon dioxide are used to make water and glucose.

Answers

Answer:

1.

Explanation:

Sunlight and carbon dioxide are used to make atp

If an animal cell is placed in a hypotonic solution, it will undergo.
O endocytosis
O exocytosis
O cytolysis
O plasmolysis

Answers

Explanation:

Plasmolysis is the process in which cells lose water in a hypertonic solution. The reverse process, deplasmolysis or cytolysis, can occur if the cell

Answer:

Hello Hanji please send phone number watsapp

An interaction in which one organism captures and feeds on another organism is called
a competition
C mutualism
b. symbiosis,
d predation

Answers

I’m sure it’s predation
D. Predation

A predator hunts its prey and comsumes it :)

Which is a symbol that represents SI units for temperature?
°C
g
Ооос
L

Answers

degrees celcius because that is a form of heat the others are mass
Degree celcius from the options. But si unit is kelvin

write a food chain from this food wed with six tropic levels

Answers

Answer:

Pri mary Prod ucers

Prim ary Con sumers

Secondary Consum ers

Te rtiary Consumers

Ap ex Pred ators

Trophic casc ade?

(i put lines because it says that i'm using "inappropriate" words.)

1.) What gives water all its properties? 2.) What type of bond joins H2O to another H2O and forms cohesion? 3.) What property of water prevents rapid temperature change inside the body of organism? 4.) Which property of water allows water to attach to roots of plants for capillary action? 5.) Water is found in many compounds such as blood, saliva, sweat because of which property of water? 6.)Which property of water causes water to form drops? 7.)Which property of water helps maintain extreme temperature changes in an area? 8.) What happens to hydrogen bonds when water turns to ice? 9.) Why doesn't water break down fat? 10.)Which property of water causes surface tension? Cohesion, Adhesion, High heat capacity, high heat vaporization and polarity

Answers

Answer:

1. polarity

2. hydrogen bonding

3. High heat capacity

4. Adhesion

5. polarity

6. surface tension

7. high heat vaporization

8. hydrogen bonds form a rigid and stable network

9. Water is a polar substance and fat is a nonpolar substance.

10. Cohesion

Explanation:

Water is a polar molecule that is held together by hydrogen bonds to form strong cohesive forces. This accounts for the surface tension in water. Surface tension is the force acting on water that it makes to behave like a stretched elastic skin.

The polarity of water accounts for the fact that it is found in several parts of the body where it largely plays the role of a polar solvent.

High heat capacity of water enables it to function well in the area of thermoregulation in the body. High heat vaporization accounts for the fact that water helps maintain extreme temperature changes in an area.

When in solid state, the hydrogen bonded network in water becomes rigid and forms a very stable network of water molecules. Being polar, water does  not interact with fat because like dissolves like.

In plants, the attachment of water to plant roots is known as adhesion and is necessary for the capillary movement of nutrients to plants via the root.

4. Why are coral reefs only found in tropical water? *
(1 Point)
They need cold water with little sun
They need deep water and humid temperatures
They require shallow waters where the sun can reach them

Answers

They require shallow waters where the sun can reach them!

Answer:

They require shallow water where the sun can reach them.

After she has viewed the cells, she wants to produce a scientific drawing of them.
Her teacher has told her to use smooth lines to draw the structures she can see.
Give two other ways in which she can make sure she produces an accurate and useful drawing.

Answers

make a large clear drawing, include magnification used, use a ruler, when labelling write horizontally forming a vertical list. hope this helps :)

After she has viewed the cells, she wants to produce a scientific drawing of them.The other ways in which she can make sure she produces an accurate and useful drawing is make a large clear drawing, include magnification used, use a ruler, when labeling write horizontally forming a vertical list.

What is scientific experiment?

An experiment has been defined as process that is designed to diagnose the hypothesis which has the portion of the scientific method or procedure.

Scientific experiment has done by testing the particular medicine on an animal and by observing the impact of medicine on the animal as well as the reaction of the animal.

There are mainly three types of scientific experiments and these are the experimental which has been consist of the major level of scientific experimentation. The second type has been known as Quasi- experimental and third type has been known non- experimental study or research.

Therefore, After she has viewed the cells, she wants to produce a scientific drawing of them.The other ways in which she can make sure she produces an accurate and useful drawing is make a large clear drawing, include magnification used, use a ruler, when labeling write horizontally forming a vertical list.

Learn more about scientific experiment here:

https://brainly.com/question/2449529

#SPJ5

What is the relationship between undisturbed sedimentary rock layers and fossils?

Answers

Answer:

A principle of law stating that within a sequence of undisturbed sedimentary rocks, that the oldest layers are on the bottom and the youngest are on the top. rock layers have a unique set of fossil animal and plant remains which can be used to determine the relative ages of rock layers.

Explanation:

Translation can best be described as: *
1.making proteins using RNA
2.making new DNA using the old DNA
3.making proteins using DNA
4.making RNA using DNA
docaribedas. *

Answers

Answer:

1 is the right answer guaranteed

When a food handler can effectively remove soil from equipment using normal methods, the equipment is considered what?

Answers

Answer:

Cleanable

Explanation:

Cleanability refers to the ease with which microorganisms or particles can be removed from the equipment used in food production. To be cleanable the roughness of the machine being employed in production is not expected to exceed 0.8μm.

The Atomic Force Microscope is used to measure the surface roughness of machines. Cleanability is important as it ensures that the machines used in food production are safe.

When a food handler can effectively remove soil from an equipment by using normal methods, the equipment is considered to be; Corrosion Resistant.

The soil referred to her would be dirt because we are talking about a food handler.

Now, if the food handler is finding it difficult to remove dirt from the equipment by using normal/regular methods, it means that the soil/dirt has succeeded in having some kind of chemical reaction with that equipment.

If that is the case, then it means the equipment is undergoing corrosion because corrosion is defined as the gradual destruction of a metal by chemical reaction with the environment.

Since we have established that inability to use normal method denotes corrosion, then if he can use normal methods to remove the soil effectively, then the equipment is said to be corrosion resistant.

Read more at; https://brainly.in/question/40223031

how far is each planet from the sun.................

Answers

Answer:

1. Mercury: 31.197 million mi

2. Venus: 66.81 million mi

3. Earth: 92.96 million mi

4. Mars: 141.6 million mi

5. Jupiter: 483.8 million mi

6. Saturn: 890.8 million mi

7. Uranus: 1.784 billion mi

8. Neptune: 2.793 billion mi

Explanation:

Hope this helps ;}

Mercury is 57,910,000 km (0.387 AU) from the sun

Venus is 108,200,000 km (0.723 AU) from the sun

Earth is 149,600,000 km (1.000 AU) from the sun

Mars is 227,940,000 km (1.524 AU) from the sun

Jupiter 778,330,000 km (5.203 AU)


Saturn 1,424,600,000 km (9.523 AU)

Uranus 2,873,550,000 km (19.208 AU) 51,118 km

Neptune 4,501,000,000 km (30.087 AU)

What are the three base sequences on a tRNA molecule called?

Introns

Exons

Codons

Anti-Codons​

Answers

Answer:

proteins are built from smaller units called and amino acids which are specified by 3 nucleotide mRNA sequences called Codons each Condon represents a particular amino acid and the each condone is recognized by a specific tRNA. have a nice day !!!!!!!

Which three of the following are examples of feedback mechanisms which help maintain homeostasis?
A antibodies binding to a virus
B flagellar rotation for cell movement
Cinsulin secretion in response to high blood sugar
D Nincresed heart rate in response to exercise
E protein synthesis
F proton pumping to maintain a proper pH level

Answers

Answer:

F proton pumping to maintain a proper pH level

What is the correct answer?

Answers

with unbalanced forces
Other Questions
what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.) What is the mass of HF produced by three reaction of 3.0 10 to the 23 molecules of H2 with excess F2 Please help this one is also due tomorrow Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas?