Is the word asked a action verb linking verb or auxiliary verb

Answers

Answer 1

Answer:  auxiliary verb

Explanation:


Related Questions

Which scene from "Stray" is an example of rising action?

A. Doris tries to convince her parents that they should keep the dog.

B. Doris brings the puppy home for the first time.

C. Mr. Lacey takes the puppy to the pound.

D. Doris discovers that her father brought the dog back.​

Answers

Answer:

I think the answer is C.

Explanation:

The rising action is A. Doris trying to convince her parents to keep the dog because this is the only event leading to the climax of the dog being taken to the pound.

6. In paragraphs 10-11, how does John Watson’s experiment support Zimbardo’s finding that “relabeling” people can affect their behavior?

Answers

Answer:

B

Explanation:

The maskers warriors became so focused on survival that they treated even civilians as threats to their lives

Insert commas where necessary in the sentence below:


That brand’s heaviest laptop weighs less not more than the daily newspaper.

Answers

The brands heaviest laptop weighs less, not more, than the daily newspaper.

Answer:

That brand’s heaviest laptop weighs less, not more, than the daily newspaper.

Explanation:

Commas are necessary before and after the words not more. Not more is another way to say less. When you use a word and then want to describe or explain it in other words (just like in this case), that description/explanation needs to be separated from the rest of the sentence by commas. This is why the given sentence should look like this:

That brand’s heaviest laptop weighs less, not more, than the daily newspaper.

Circle the big pronoun then rewrite the sentence so that the meaning is clear Nigel and Mario took the twins to the park and they didn't want to go home

Answers

Answer:

i aint ever seen two pretty bes friends its always one of em gotta be ugly

Explanation:

thats why yo shoes ragedy... thats why yo mama dead, dead as heck

um... chile anyways sooo

Answer:

the 2nd they

Explanation:

pls give me brainliest

Which of the following does NOT describe the meaning of the term point of view?
A. the place from which readers watch the unfolding action of a story
B. the hints of future events in a story
C. the vantage point from which a story is told
D. the "eyes" through which we see story events

Answers

Answer:

B. the hints of future events in a story

Explanation:

The hints of future events in a story is the definition of foreshadowing.

The hints of future events in a story is not describe the meaning of the term point of view. Hence option B is correct.

What is point of view?

Point of view is defined as the narrator's view point in connection to the events in the story. A key literary device for examining a story is point of view. The reader's interpretation and interaction with the story might be influenced by the author's choice of point of view. Point of view can be used to convey the feelings, thoughts, motivations, and experiences of one or more individuals.

Who is narrating or telling a tale is referred to as the point of view. You can tell a story in the first person, second person, or third person (POV). POV is a technique used by authors to convey the inner feelings of either their own characters or themselves.

Thus, the hints of future events in a story is not describe the meaning of the term point of view. Hence option B is correct.

To learn more about point of view, refer to the link below:

https://brainly.com/question/11983141

#SPJ2

Describe one Communication strategy that Jacey can use when presenting the idea to her supervisor.​

Answers

Answer:

Explanation: If you want to be a good manager, you need good communication skills. ... Maybe your whole team will continue working remotely, or perhaps you'll need to ... feel more comfortable using them when communicating with employees. ... rather than silently formulating a response while they're speaking to you.

The communication strategy that Jacey can use when presenting the idea to her supervisor is a verbal communication strategy.

Communication strategy simply means the plan that's used by a person to communicate with someone else. Communication strategy is also used by companies to achieve their objectives.

Jacey can use the verbal communication strategy when presenting the idea to her supervisor. Jacey should ask open-ended questions and communicate effectively. He should also listen to the opinion of the supervisor.

Read related link on:

https://brainly.com/question/19196640

Which of the following statements is true about narrative text? (5 points) a It is only written to entertain or inform readers. b It has so many purposes there is no clear definition. c It may inform, persuade, entertain, inspire, or teach. d It has no purpose other than to persuade people to buy it.

Answers

Answer: I'm pretty sure the answer is c:It may inform, persuade, entertain, inspire, or teach.

Answer:

c I just took the test

Explanation:

Please help me I need a objective summary of Marian revolution

Answers

Answer:

She was the first African American singer to perform at the White House and also the first African American to sing with New York's Metropolitan Opera. Marian Anderson was born in Philadelphia on Feb. 17, 1902, and was educated in the public schools. She displayed a remarkable flair for singing when very young.

Explanation:

Marian Anderson was an American contralto. She performed a wide range of music, from opera to spirituals. Anderson performed with renowned orchestras in major concert and recital venues throughout the United States and Europe between 1925 and 1965.

Read the excerpt and analogy, then answer the question.

Animal Farm

And in many ways the animal method of doing things was more efficient and saved labour. Such jobs as weeding, for instance, could be done with a thoroughness impossible to human beings. And again, since no animal now stole, it was unnecessary to fence off pasture from arable land, which saved a lot of labour on the upkeep of hedges and gates. Nevertheless, as the summer wore on, various unforeseen shortages began to make them selves felt.

arable : fertile :: clouded : vague

In at least one hundred words, how does the analogy help the reader to understand the meaning of the word arable in this excerpt?

Answers

Answer:

The issue of shortages foreshadows that the farm will experience difficulties in the future.

Explanation:

Which transitional word or phrase is most common in the chronological organizational pattern?


Next,


For instance,


For this reason,


Similarly,

Answers

Answer:

A. next.

Explanation:

I am not 100% sure, but that one is the one that makes more sence writing.wisc.edu › handbook › style

Transitional words and phrases can create powerful links between ideas in your paper and can help your reader understand the logic of your paper. However, these words all have different meanings, nuances, and connotations. Before using a particular transitional word in your paper, be sure you understand its meaning and usage completely and be sure.

A  transitional word or phrase most common in the chronological organizational pattern is Next. Thus the correct option is A.

What are Transitional words?

Professionals integrate paragraphs, ideas, and textual components quickly and effectively using transitions. By logically connecting text sections together, transition words to aid in consistency, mobility, and understanding between them.

The transition word next is used to connect the sentence with upcoming events. It helps the reader to determine the sequence of events by using next.

Next is transition word as it helps the reader to know about what is going to place in upcoming events. It helps to establish bridges between customers and helps to establish better connections.

Therefore, option A is appropriate.

Learn more about the transitional word, here:

brainly.com/question/2372495

#SPJ5

This is a list of similar words. Choose the correct answers and write them in the blank.

A) draft, B) build, C) constructed, D) formulated, E) composed, F) invented, G) fabricate, H) manufacture, I)devise, J) model

1. The multi-national company has set up a factory in Singapore to () handphone accessories.
2. The lawyer has been asked to () a contract that will list out the terms and conditions of our agreement.
3. In the Arts and Crafts Workshop, participants will be taught how to () various objects from clay.
4. To avoid getting into trouble with her parents, Pauline () a lie to explain why she was home late.
5. The portable water purifier has been () by one of our Science Club members.
6. The administrator has been asked to () a system that can track absenteeism.
7. The vendors at the night market have () makeshifts stalls using metal bars and wooden planks.
8. The security committee has () a plan to nab a serial shoplifter in its stores.
9. The versatile artiste is singing a song that she has () herself.
10. The developer plans to () four blocks of 15 storey residential apartments an this empty plot of land.​

Answers

Answer:

A- 7

B- 6

C- 4

D- 5

E- 9

F- 8

G- 10

H- 1

I- 2

J- 3

Explanation:

hope this helps :)

Which words help create the mood in the excerpt?
Check all that apply.
distance
shouting
Read the excerpt from Warriors Don't Cry.
As we approached behind them, we could see only the
clusters of white people that stretched for a distance of
two blocks along the entire span of the school building.
My mind could take in the sights and sounds only one
by one: flashing cameras, voices shouting in my ears,
men and women jostling each other, old people, young
people, people running, uniformed police officers
walking, men standing still, men and women waving
their fists, and then the long line of uniformed soldiers
carrying weapons just like in the war movies I had
seen.
jostling
fists
long
weapons
movies

Answers

Answer:

shouting

jostling

fists

weapons

Explanation: The guy above me missing weapons

Answer:

The guy above is def correct I got it right on the Exam review too

Explanation:

Help Asap!

As a growing adolescent, what makes life stressful and why?

Answers

Explanation:

Your body goes threw many changes such as puberty. Puberty can cause stress when you are always tired or have a zit and even when you don't know how to feel it can cause stress. Also going threw different hormonal stages threw out growing up. You are in the rebellious stage who wants to talk back and argue for a point to prove. Most teenagers deal with anxiety, stress, and fear.

Now can I have brainless t

Answer:

Most teens experience more stress when they perceive a situation as, dangerous difficult and painful and they do not have the resources to cope. some source of stress for teens include.School's demands and frustration negative thoughts or feeling about themselves.

Part A

In “How a Cat Played Robinson Crusoe,” what inference can be made about the cat's behavior while the family is still on the island?


She often gets food for herself.

She sometimes stays out all night.

She is afraid of certain things on the island.

She is used to going in and out of the house.
Question 2
Part B

Which evidence from the text best supports the inference in Part A?


“The cat had always been so coddled and pampered by the children that she had had no need to forage for herself.”

“Fortunately for her, she had learned to hunt the marsh mice and grass sparrows for amusement.”

“Still and desolate in the bright sunshine and the tearing wind, the house frightened her.”

“She could not understand the tight-closed shutters, or the blind, unresponding doors that would no longer open to her anxious appeal.”

Answers

Answer:

For part A its She is used to going in and out of the house and for Part B its She could not understand the tight closed shutters,or the blind, unresponding doors that would no longer open to her anxious appeal.

Explanation:

I took the test and those where the answers

Out of the choices provided above, it can be concluded to state that the answers for both the parts of ''How a Cat Played Robinson Crusoe?'' can be written as below,

for Part A- She is used to going in and out of the house;for Part B- “She could not understand the tight-closed shutters, or the blind, un-responding doors that would no longer open to her anxious appeal.”

Therefore, the options 1-D and 2-D hold true.

What is the significance of “How a Cat Played Robinson Crusoe,”?

The story of “How a Cat Played Robinson Crusoe,” is based on the main conflict that how pampered lifestyle a cat enjoys while she is still a pet of the family that has gone to live on an island.

The behavior of the cat throughout the story is used to going in and out of the house as a part of her conditioned behavior. She is also not known to some things that are unusual to her life that tell much about the cat's anxious appeal.

Therefore, the options 1-D and 2-D  holds true and states regarding the significance of “How a Cat Played Robinson Crusoe,”.

Learn more about “How a Cat Played Robinson Crusoe,” here:

https://brainly.com/question/7198166

#SPJ2

Why might Atticus not want his kids to know about the rest of his family?

Answers

Answer:

lol

Explanation:

Answer:

because atticus is having problems with his famialy

Explanation:

What effect does the diction used in the dialogue in paragraph 2 have
on the passage?
O
A. It sets the speaker up as an educated character.
O
B. It identifies the speaker as an authority figure.
O C. It characterizes the speaker as being of a certain age and
class.
D. It shows the relationship the speaker has with the main
character.

Answers

Answer:

B

Explanation:

The jury has given its verdict.

Is Jury an abstract or collective noun noun?

Answers

Answer:

jury means the team of judges to give the judgement therefore it is a collective noun.

Explanation:

please Mark as brainliest

PART B: Which TWO Sections best support the answers to Part A of Hurricane Katrina?

Answers

Answer:

what sections?

Explanation:

chapter 22 summer of mariposas summary? pls

Answers

Answer:In chapter 22 of summer of la mariposa Odilia is having her sweet 16th birthday party she has grown up a lot Odilia and her sister are starting to go back to school. Mama has also gone back to school and now has a job in a private school and her boss does not mind that she keeps a close eye on the girls.  While the party Odilia's father shows up she begins to talk to Odilia and as he talks Odilia becomes more clear of why he is here he wants to talk to mama. But after talking to Odilia he decided to leave, Odilia wasn't mad she was happy.

Explanation:

The summary of Chapter 22 of Summer of the Mariposas by Guadalupe Garcia McCall recalls the return of Odilia's absent father at her 16th birthday party.

This 16th birthday happened after Odilia with her sisters had returned from their Odyssey journey from the world of the spirits, helped only by a benevolent spirit, La Llorona. They had earlier embarked on the cross-border journey to return the body of a dead man that they found in the Rio Grande.

Earlier, the father of the four sisters had disappeared.  Perhaps, he followed another woman while abandoning the girls to the care of their mother. But on Odilia's 16th birthday, the father reappeared to seek reconciliation with their mother.

Thus, the summary of Chapter 22 is about Odilia's 16th birthday party and the return of their runaway father.

Learn more: https://brainly.com/question/21901162

4.PART B: Which phrase from the text best supports the answer to Part A?

A“‘Mahalia, you are giving me the Lord's voice this morning.’” ( Paragraph 9)

B“While he was reading from the prepared text, Jones says, Jackson shouted at King.” ( Paragraph 11)

C“King had delivered a rousing speech earlier that summer at Detroit's Cobo Hall…” ( Paragraph 12)

D“…he took the text of the speech — the written text that he was reading — and he moved it to the left side of the lectern…” ( Paragraph 13)

commonlit

Answers

What was your answer to part A?

Choose one of the two response formats and write an introduction using the
information below.
Name of article: “The Friendship of Boys”
Name of author: Mike Barns
Quote: “When boys compete with each other, it can be a form of
bonding?
Paraphrase: Some boys develop friendship through competitive
activities.
Introduction:​

Answers

Answer:

boys can be very competitive it comes as a form of friendship

التاريخ / / ۱
*
الموضوع
Why do o we read literatures?​

Answers

Answer:

em -__- im dum

Explanation:

You can use the rule S, fanboys s. to join together two complete sentences. True or False​

Answers

True. FANBOYS are coordinating conjunctions. This means that they can be used to connect two independent clauses (or in this example, complete sentences).

Example: I love to eat pizza, and I love to eat ice cream.

I love to eat pizza, but I love to eat ice cream even more.

2 points
6. What literary element is used in the following quote from "The Tell-Tale
Heart"? "...a low dull quick sound, such as a watch makes when enveloped
in cotton."

Answers

Answer:

Imagery

Explanation:

Imagery is a powerful tool used by many writers. It refers to the use of figurative and metaphorical language to create images in the mind of the reader through their senses.

Edgar Allan Poe does this in his short story The Tell-Tale Heart, as well. He describes a sound as low, dull, and quick, like the one a watch wrapped up in cotton makes. We can imagine what that sound is like, which makes us feel like we are a part of the story.

What does the word unfurled in paragraph 7 BEST exemplify? OA. the vastness of the land B. the uniqueness of the environment O C. the confusion caused by being outdoors D. the frustration resulting from being alone







She stood , finally , her canvas Keds tied tight , on May 3 , 1955 , atop the southern terminus of the Appalachian Trail , the longest continuous footpath in the world , facing the peaks on the blue- black horizon that stretched toward heaven and unfurled before her for days . Facing a mean landscape of angry rivers and hateful rock she stood , a woman , mother of eleven and grandmother of twenty - three . She had not been able to get the trail out of her mind . She had thought of it constantly back home in Ohio, where she tended her small garden and looked after her grandchildren , biding her time until she could get away .

Answers

Answer:

A

Explanation:

Unfurled means to spread out from a tight spaced or a small state and to go somewhere more opened to the air

The word unfurled in paragraph seven best exemplifies as the vastness of the land. The correct option is A.

What is a paragraph?

A structured, cogent succession of sentences that are all related to the same idea is a paragraph. Almost all of your work that is longer than a few sentences needs to be divided into paragraphs. Typically, a paragraph only addresses one idea.

Typically, you'll introduce that topic with one sentence and then use a number of supporting sentences to complete it. The typical length of a paragraph is between 100 and 200 words, however, this generalization is more flexible than you may think.

You can compose and organize paragraphs using this simple paragraph structure, which will assist each paragraph flow into the next.

Therefore, the correct option is A. the vastness of the land.

To learn more about a paragraph, refer to the link:

https://brainly.com/question/24465045

#SPJ5

We (should/should not) forget all rules of the English language when filling out a written or electronic job application because

Answers

Answer:

should not make mistakes

Explanation:

Should not

1. Not following directions

2. Leaving a field blank on the job application

3. Forgetting to attach the correct documents

4. Not tailoring your application to the job description

5. Applying for all positions at the company

6. Applying for a position that you are obviously not qualified for

7. Not explaining employment gaps

8. Underselling yourself

9. Using improper grammar

10. Lying

Should do

Ms. Kaplan is a new fourth grade teacher who feels passionate about helping students learn. She is teaching in a poverty-stricken area of Houston and knows that many of the students receive little academic support and encouragement at home. Its the fourth week of school, and she feels good about the way her class is progressing, learning routines, and meeting her expectations. Today she entered the teachers lounge and heard two other teachers talking about Michael, one of her African American students. When she entered, they told her they had taught Michael in second and third grades. They warned her that Michael would cause trouble, fail to complete his work, and distract other children. They described Michaels poor academic performance and said his mom doesnot support the teachers efforts. After Ms. Kaplans experience in the teachers lounge, consider the possible dilemmas that might arise regarding her expectations of Michael. Describe common negative effects that might occur and explain how Ms. Kaplan might prevent such effects.​

Answers

Answer:

My Opinion

Explanation:

i feel that the students in that class will start disrespecting her not following rules and will eventually Stop following the expectations, Michaels parents will not respect her order of authority and will most likely go against what she says

(Giving brainliest and extra points!! Sorry if its long lol)


Scene One


On an overcast autumn afternoon in the middle of a field with many apple trees. A brother and a sister have a ladder up against an apple tree. One is picking apples and placing them in a sack tied around her waist. The other is holding the ladder steady.


Mischa: (standing on the ladder and looking at an apple) I'm not so sure about these. They have a ton of spots and are not quite ripe.

Luke: That's alright, we're just making a pie for Sunday dinner anyway. No one will see the spots, and we can add sugar to sweeten them up.

Mischa: (Nodding in approval) Yeah, I guess you're right. Mom always likes her pie apples to be a little firm anyways.


Suddenly, the wind begins to blow strongly making the ladder tip back and forth slightly.


Mischa: (With an alarmed look on her face.) What's going on? There isn't supposed to be a storm today! We'll never make it back to our house before it hits!

Luke: (Holding onto the ladder as hard as he can) You need to come down! I can't hold the ladder much longer!

Mischa carefully but swiftly climbs down the ladder while the wind is still blowing. Luke holds on to the ladder as it sways back and forth. Mischa makes it to the bottom. They both look toward dark clouds rolling in quickly with thunder and lightning.


Luke: (Yelling over the storm) We'd better find some shelter! (Pointing toward a rundown old farmhouse.) I think there's an old farm house that way!

Mischa: (Also yelling) You lead the way. I'm too scared!

Luke: (Grabbing her by the hand) It's going to be okay! Run with me!

Both children run to the old farmhouse holding each other's hand. When they make it there, they enter through an open window.



Scene Two


In the kitchen of the old farmhouse. There is an old dusty table and chairs, but everything else including the stove is gone. The windows are broken, the curtains tattered, and the wallpaper peeling. The wind is picking up and blowing through. The children are calming down. Mischa looks out the broken window where a large dead tree sits close to the house, while Luke sits at the old table. The sack of apples sits on the table.


Mischa: It's almost here Luke. The branches on the trees are swaying all over the place.

Luke: (Looking at the old tree through the window) Come away from the window Mischa. It's a really bad storm, that's for sure.

Mischa: (sitting down in the chair opposite Luke.) I think it's a tornado.

Luke: It's not a tornado, but those are some heavy winds.


The wind picks up and the curtains sway violently. Something smacks up against the side of the house.


Luke: What was that? It's picking up.

Mischa: Where are Mom and Dad? Why aren't they here to help us?

Luke: Never mind that. We need to worry about ourselves right now. I think we should go down to the ...


Suddenly, a tree branch hits the window smashing it even more than it was. Luke and Mischa scream.


Mischa: (Yelling) To the basement!


The children run toward the basement when Mischa stops and turns back.


Luke: (Still yelling) What are you doing? Come back!

Mischa: (Still yelling) The apples! I need to grab the apples!

Luke: Mischa no!

Mischa runs to grab the apples. She gets a hold of the sack and turns around toward the basement again. As she gets to the basement door, the old large tree snaps, cracks, and falls through the kitchen wall. She is okay, but shaken.


How does the structure in scene one complement the events in scene two?

A) Scene one describes only two of the characters that will appear in the next scene.
Nothing tells the reader about their relationship in scene one.

B) Scene one describes the setting, introduces the characters, and introduces a storm that calms down in in the scene.

C) The first scene describes the setting, introduces the characters, and introduces the storm that the characters will face in scene two.

D) Scene one introduces the characters, and introduces the outdoor setting that the characters interact in throughout the play.

Answers

Answer:

its d

Explanation:

Answer:

D. Scene one introduces the characters, and introduces the outdoor setting that the characters interact in throughout the play.

Explanation:

Select the noun clause in each sentence
Whatever you do make sure you're home on time.
Janice couldn't decide what she should major in at college

Answers

Answer:

Noun clauses are dependent clauses acting as nouns. They begin with words such as how, that, what, who, whoever, whom, where, when, whether, which, whichever and why.  What is more, they can act as subjects, direct objects, indirect objects, predicative nominatives or as objects of prepositions.

Taking all this into account, the noun clauses found in the sentences presented are the following ones: "whatever you do" and "what she should major in at college".  In both cases, the noun clauses in question are actings as the subjects of the sentences.

Answer:

whatever you do

what she should major in college

Explanation:

Jonas is creating a presentation for students about volunteering. He wants to begin by speaking about the various opportunities available, but he also wants to use multimedia to engage the students.

Which is the most appropriate media resource for Jonas to use?

a chart listing the volunteering opportunities and their benefits
a video in which students talk about volunteer experiences
a speech from the principal about volunteering
a timeline showing the history of volunteering

Answers

Answer:

A video in which students talk about volunteer experiences

Explanation:

A is the correct answer
Other Questions
Which ordered pair is a solution of the equation -4x + 7 = 2y - 3 which set of the numbers is equivalent to 75%? (0.75 3/5), (7.5 75/100), (3/4 0.075), (15/20 0.75) Identify the independent variable (domain). 5x+2y= 150 I WILL GIVE A LOT OF EXTRA POINTS. PLEASE ANSWER ALL OF THEM The manufacturers of can of salted mixed nuts state that the ratio of peanuts to other nuts is 6 to 5 . If 414 peanuts are in a can how many other nuts should also be in the can (8,9), X + 8y = 9Help me please What is 15% of 140? A.2,100 B.30 C.21 D.119 What was a vassal required to pay to their lord? crops money land tares Helppp ASAP. Emma wants to enlarge a square photo and print it to a square canvas. The sidelength of the canvas is 12 in. The scale from the canvas to the photo is 4 in. to 1 in.What is the side length of Emma's photo? Show your work. What other story element is most affected by the narrator's point of view?A) the story's titleB) the story's settingC) the story's theme Express the recurring decimal 0.56 (Just the 6 is recurring) in its simplest form. What should you ask yourself before you post a photo, video, or other information about another person online? 1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in?