list down the part of the human body​

Answers

Answer 1

Answer:

The brain. The brain is the control centre of the nervous system and is located within the skull. ...

The lungs. ...

The liver. ...

The bladder. ...

The kidneys. ...

The heart. ...

The stomach. ...

The intestines

Answer 2

Answer:

2

Explanation:

there are two parts of human body

1st: internal human body

2nd: external human body


Related Questions

pls help
Static, PNF, and dynamic stretching all have different attributes that contribute to fitness development. Differentiate each of the types of stretching (static, PNF, dynamic) and discuss the benefits and limitations of each.

Which is most effective? Give evidence to explain why.

Answers

Answer:

Static stretches are those in which you stand, sit or lie still and hold a single position for period of time, up to about 45 seconds. Dynamic stretches are controlled movements that prepare your muscles, ligaments and other soft tissues for performance and safety.Dynamic stretching is an excellent stretching method for pre-competition movement. It helps warm up your muscles while you are moving and stretching in coordinated movements. On the other hand, PNF stretching is best utilized to improve range of motion.

Static is most effective . Bcoz of Stretching exercises have traditionally been included as part of a training and recovery program. Evidence shows that physical performance in terms of maximal strength, number of repetitions and total volume are all affected differently by the Each.

Explanation:

Hope this helps !!

Which describes body composition?
a)They block pain messages from reaching brain cells.

b)They lower blood cholesterol levels.

c)They allow the heart to pump more blood with less effort.

d)They increase the body’s basal metabolic rate.

Answers

Answer:

B.They lower blood cholesterol levels

#carryonlearning

Illiterate the relation of science and technology with health population and environment education

Answers

Science and technology is co-related with health, population and environment. They are the significant means of development process. It's making the human life more comfortable and productive invention of various technology has made the treatment of health easy and reliable.

Consider this claim, “Working with a teammate or partners to achieve fitness goals is better than working individually.” Do you agree or disagree with this opinion? Please elaborate and explain

Answers

Answer:

agree

Explanation:

Because it will motivate you to work hard

Awnser this with a fun fact about yourself, and I will mark brainliest. ​

Answers

I was adopted when I was a baby

TRue or false once you identify a person who is suicidal does asking more questions help most times

True
False

Answers

Answer:

True

Explanation:

It can distract them intell someone that can help gets there

Answer:

true

Explanation:

it can encourage them to be honest

write paragraph highlighting importance of good nutrition and hydration

Answers

Answer:

the importance of good nutrition has many different benefits. such as staying healthy, staying fit, and maintaining a good ideal weight for yourself. good nutrition also reduces high blood pressure and it can  lower high cholesterol. Having good nutrition can help: reduce the risk of different  diseases such as  diabetes, heart disease, stroke, various types of cancers, and osteoporosis. If you have good Nutrition you can improve your overall well-being, improve your ability to fight off illness, improve your ability to recover from illness or injury and more importantly increase your energy level. having good nutrition is a very important key in life of staying physically healthy. also good hydration is very important in life, without water, you will be dehydrated. and that is never good in any sort of way. being hydrated helps your body in many ways. Dehydration is a problem that can be fixed easily through self-awareness and a conscious effort to drink. Many techniques exist to help facilitate and encourage water consumption: making drinking water a habit; keeping a liquid journal; and making water more appealing. Although the topic of water consumption and drinking eight glasses of water appears to be such a simple element of health, it is key to effective body function, and optimal health. Hydration with water and other water-based liquids is critical for survival and functioning of the body’s organs. Water is 60% of the total human body composition.

Explanation:

Question # 8
Multiple Choice

The idea of interdisciplinary teams _____.

has been around since the 1940s
is new to health care
has been around since ancient times
started in the 1970s and 1980s

Answers

Answer:

started in the 1970s and 1980s

What are other examples of quick breads?

Answers

Explanation:

Quick breads include many cakes, brownies and cookies—as well as banana bread, beer bread, biscuits, cornbread, muffins, pancakes, scones, and soda bread.

which body system is responsible for carrying oxygen from the lungs to the body cells and transporting glucose for energy?

Answers

Answer:

The circulatory system.

Explanation:

The oxygen is carried to the blood lines and is carried through the arteries and veins that also take away tissue waste and matter.

3. A(n)______ is someone who travels to new places or does new things. A. explorer B. thrill C. expedition D. research

Answers

Answer:

A.explorer

Explanation:

one that explores especially : a person who travels in search of geographical or scientific information. 2 capitalized : a member of a coed scouting program of the Boy Scouts of America for young people ages 14 to 20 focusing on career awareness.

TIP-We don't really need to know the meanings of these words because you can use the sentence as a Clue.

Clues in the sentence are

Someone                 Someone is a clue because we now know that the answer                

                                 is a noun in which we can cross out the answer choices C                  

                                 and D

With the answer choices C and D crossed out, we have the answer choices A and B.

At this moment we need to know what these words mean.

Explorer is a person that finds a place new

So the asnwer is A

which major muscle group does the bench press and push-ups strengthen

Answers

chest muscles, or pectorals
shoulders, or deltoids
back of your arms, or triceps
abdominals
the “wing” muscles directly under your armpit, called the serratus anterior

approximately how many calories are in a banana that has 20 grams of carbohydrate?

Answers

It probably has 72-135 calories

There are 18 calories in 20 grams of banana. It provides us with energy.

What are calories?

Calories are the units of energy used by your body during food digestion and absorption. A food might provide your body extra energy if it has more calories. We need energy for our daily activities.

Your body stores extra calories as body fat when you consume more calories than you need. Even f6ods without fat might have a lot of calories.

A medium banana has roughly 105 calories, 3 grams of fiber, and the fruit's natural sugar (A quick rule of thumb is that one serving of carbohydrates should provide at least 3 grams of fiber). As you surely already know, bananas also contain a lot of vitamins, including potassium. Hence, there are 18 calories in 20 grams of banana.

Learn more about calories, here:

https://brainly.com/question/22374134

#SPJ6

is it safe to use a vibrating massager during pregnancy

Answers

yes it is safe to use a vibrating massager during pregnancy

what ear structure vibrates back and forth when sound waves strike?

Answers

Answer:

See explanation

Explanation:

The tympanic membrane or eardrum serves as a divider between the outer ear and the middle ear structures. It is gray-pink in color when healthy and consists of three very thin layers of living tissue. The eardrum is very sensitive to sound waves and vibrates back and forth as the sound waves strike it.

Where do you see your personal fitness ten years from now? Twenty years? Describe the role that you see personal fitness playing in your future.

Answers

Personal fitness will help us as individuals to become physically fit and able

to perform various activities as we grow old.

Personal fitness involves performing various physical activities such as

running, jogging, skipping etc. These activities help to build up our muscular

endurance and increase in cardiovascular activities.

The effects helps individual cells to become more strengthened , energetic

and free from various diseases thereby promoting healthy living and long

life in general.

Rad more about Personal fitness here https://brainly.com/question/22099223

the maximum fine for driving and drinking an alcoholic beverage is

Answers

Answer:

the maximum fine for driving and drinking an alcoholic beverage is upto $500.

How have high taxes on tobacco products impacted the number of people who use them?
A.
The number of tobacco users has increased.
B.
The number of tobacco users has decreased.
C.
The number of tobacco users has not changed.
D.
The number of adolescent tobacco users decreased, while the number of adult users increased.

How have high taxes on tobacco products impacted the number of people who use them?
A.
The number of tobacco users has increased.
B.
The number of tobacco users has decreased.
C.
The number of tobacco users has not changed.
D.
The number of adolescent tobacco users decreased, while the number of adult users increased.

Answers

Answer:

Explanation:

C.

The number of tobacco users has not changed.

(im not sure but i think that is

High taxes on tobacco products has not impacted the number of people who use them as the number of tobacco users has not changed. So, Option C is correct.

At present, these products are subject to a 28% Goods and Services Tax (GST) rate. The 28% rate is the highest GST rate with an additional compensatory cess. Tobacco products have a cess rate of 290%. The cess rate is calculated on the basis of the actual sale value (ADV).

According to a report by the World Health Organization, tobacco use costs the global economy over $1 trillion in healthcare costs and lost productivity every year.

Therefore the correct option is option C.

To learn more about the tobacco products, refer to the link:

https://brainly.com/question/984821

#SPJ3

When can I find happiness or where is happiness located or where does it spawn? (◐‿◑)

Answers

Happiness is located in our harts:)

A nurse is caring for a patient with a mediastinal chest tube. One hour after walking the patient around the unit, the nurse notices an increase in the amount of drainage from the patient's chest tube. Which statement is true regarding this finding?

A. An increase in drainage after ambulation is normal but should be monitored closely.
B. The patient should have a chest x-ray because tamponade may be developing.
C. A decrease in the amount of drainage is normal, and the practitioner should be notified.
D. An increase in serous drainage could indicate a ruptured suture line

Answers

Answer:

A

Explanation:

An increase in drainage after ambulation is normal but should be monitored closely in patients with the mediastinal chest tube. Thus, option A is correct.

What is a mediastinal chest tube?

Mediastinal chest tubes are used to remove the blood from the pericardial space after cardiac surgeries so, as to prevent blocking and clots the tubes are used. The drainage is normal after the surgeries but should be checked for excess drainage.

Therefore, an increase in drainage is normal after ambulation.

Learn more about chest tubes here:

https://brainly.com/question/14377971

#SPJ2

what is substance abuse?

the over use and abuse of drugs
reaction to a drug
when the body becomes use to a drug
none of the above

Answers

Answer:

To over use and abuse of drugs

Explanation:

Drugs are good only in less amountExcessive use of drugs harm our body.It affects our emotions and physical strength.It may be harmful for life

during a heartbeat, the atria relax as the _____ contract.

Answers

The answer is ventricles

During prerace, an athlete who weighs 70 kg would need between _____ and _____ g of carbohydrate daily.

Question 38 options:

325, 845


352, 453


490, 910


546, 1025

Answers

490, 910

Explanation:

an athlete who weighs 70kg would need between 490 and 910 g of carbohydrates daily

Answer:

what the other guy said 490 910

Explanation:

Drag each tile to the correct box.
Match each appropriate technology to the situation.

1-cloud technology
2-smart watch
3-MEDLINE
4-electronic health record

A.Dr. Shah wants to check if his patient has a
history of allergies.
B.Dr. Thomas wants her client to monitor her
heart rate through the day.
C.A senior cardiologist accesses the report of a PET scan via email while he is travelling,
D.Laura, a nurse aide, is keen to improve her knowledge about certain illnesses.

Answers

Answer:

1 - C

2 - B

3 - D

4 - A

Explanation:

the process of ______________ involves removing all visible soil from surfaces and instruments.

Answers

There are several processes used to explain the removal of dirts or contaminants from surface, but the general name is called Cleaning

Cleaning is an umbrella name that involves the removal of visible soils mater from surfaces, there are other types of cleaning that involves the removal of non-visible matter from surface too e.g sterilisation.

Sterilisation refers to specific action taken to reduce the hazard posed by such contaminants, as opposed to general cleaning.

Learn more about cleaning here:

https://brainly.com/question/19819390

Chemotherapy uses __________ to destroy cancer cells. A. radiation B. hormones C. drugs D. surgery Please select the best answer from the choices provided. A B C D

Answers

Answer:

It’s a radiation ☢️

Explanation:

C. Drugs because it seems to be really the most logical one to have as a an answer but it’s the right answer

Going too far beyond what the body can handle with vigorous exercise, especially without taking time to build up to the level of exercise, is an example of __________. A. Overuse B. Overexertion C. Incorrect technique D. Determination Please select the best answer from the choices provided. A B C D.

Answers

Going too far beyond what the body can handle with vigorous exercise, is an example of Overexertion. It is caused by repetitive muscle movements.

Overexertion refers to repetitive and sudden muscle movements, which are associated with a long physical effort.

Overexertion may lead to health problems such as fatigue, pain or even produce muscle injuries or bone fractures.

This type of injury (overexertion) may also be associated with mental exhaustion when brain efforts are beyond the current abilities.

Learn more in:

https://brainly.com/question/1305458

I know I am late but for the future people the answer is B

got it right on edge

:)

Have a good day .

how is weight loss a symptom of several different digestive disorders?

Answers

Because it decreases the amount of calories and nutrients the body is able to absorb.

how long is greek yogurt good for after the expiration date

Answers

Answer: 14 to 24 days

how much more than 79 is 78 + 18?

Answers

It’s is 17
79+18 is 96
17-96=79
Therefore the answer is 79

17 is more than 79 is 78 + 18 as 78+18= 96, when 79 substracted from 96 then, 96-79= 17.

What is Subtraction?

The four mathematical operations are addition, multiplication, division, and subtraction. Removal of items from a collection is represented by the operation of subtraction. For instance, in the following image, there are 5 2 peaches, which means that 5 peaches have had 2 removed, leaving a total of three peaches.

Subtraction is the activity or procedure of determining the distinction between two amounts or numbers. The phrase "simply removing one number from another" is also used to describe the act of subtracting one number from another. Making payments, sending cash to pals, and many more situations call for the use of subtraction. For above example, when 79 substracted from 96 then, 96-79= 17.

Thus, 17 is more than 79 is 78 + 18 as 78+18= 96

Learn more about Subtraction, here:

https://brainly.com/question/2346316

#SPJ3

Other Questions
1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet 3. Solve the formula A = 1/2 (b1+ b2))h for h. Show your work. The Silk Road was specifically developed to _____________. If you _____________ your homework before dark, I will take you to the mall. finish had finished will finish finished hiil have some dought Based on the passage, insulators and conductors differ inAthe number of protons they have.Bthe way they allow or resist the flow of electricity.Cthe way they allow or resist the movement of neutrons.Dhow much mass their atoms have. As you read lines 1-38 of "Who Understands Me But Me, begin to collect and cite text evidence. . a. Identify each thing the speaker lives without in lines 1-16. b. Explain what setting the speaker evokes in lines 1-16. c. Explain what the speaker finds when he follows the tracks (lines 30-38).