Look at the photo. Explain how it shows both an individual and a community

Look At The Photo. Explain How It Shows Both An Individual And A Community

Answers

Answer 1
There are both living things ig

Related Questions

At what stage of the cycle does the cell copy its DNA?

Answers

Answer:

S-Phase

Explanation:

During the S-Phase, the cell replicates its DNA. Interphase is then followed by Mitosis. Mitosis is when the cell separates its two sets of DNA and divides it into two more cells.

Paragraph about Photosynthesis

Answers

Answer:

Photosynthesis is the process of making food by green plants in the presence of sunlight.

Explanation:

During Day, sunlight enters through stomata and carbon dioxide from air and water forms glucose and oxygen. This process is photosynthesis.

What happens if oranisms fall to adjust and respond to changes in their environment?

Answers

Answer:

they would probably go extinct

Explanation:

I’m assuming the whole environmental system would collapse animals would die off including humans

Which one is the correct answer?? The lined squares in the Punnett square represent____.

Answers

They represent the parent's genotypes.

which of the following cells shows the process of a nucleus? a. prokaryotic b. eukaryotic c. both

Answers

Answer:

b. eukaryotic

Explanation:

"Eukaryotic" means to have a nucleus.
eukaryotic because the other one lacks a nucleus

Outputs of photosynthesis

Answers

Answer: carbon dioxide, water molecules, glucose, and oxygen

Explanation: Energy is used to convert carbon dioxide into oxygen and glucose.


Which two cell types in placozoans make up the endoderm tissue layer?

A)cover cells and cylinder cells
B)gland cells and cover cells
C)fiber cells and cover cells
D)gland cells and cylinder cells

Answers

Answer:

D

Explanation:

I made a 100 on the text

Two cell types in placozoans make up the endoderm tissue layer are - D) gland cells and cylinder cells.

The Placozoa a marine free-living multicellular basal form of organism. These are condisered as the simplest structure of all animals.

It has three genera namely Trichoplax adhaerens, Hoilungia hongkongensis, and Polyplacotoma mediterranea.It has three tissue layers that are ectoderm, endoderm and mesoderm.The ectoderm are formed of cover cells.The bottom layer is made up of cylinder cells that has cilia used in locomotion, and gland cells that lack cilia.

Thus, two cell types in placozoans make up the endoderm tissue layer are - D) gland cells and cylinder cells.

Learn more:

https://brainly.com/question/4580106

Which of these groups contains single-celled organisms?

A. birds
В. plants
C. fungus
D. animals

Answers

Answer:

C. Fungus

Explanation:

The fungi kingdom includes both single cell and multicellular organisms. Single cell organisms in the fungi kingdom include yeasts and chytrids, or fossilized fungi. Most organisms within the plant and animal kingdoms are multicellular. The Largest Single-Celled Organism.

hope i helped

Answer:

C. fungus

Explanation:

Birds and animals are in the same category, and both have multiple cells.

Plants also have multiply cells.

And fungus can be single celled or multiple cells.

Hope this helps ya!!

Albino individuals lack all pigmentation so that their hair and skin are white. The
transmission of Albinism is shown on the pedigree below.

According to the pedigree, what is the mode of inheritance for this condition?

Answers

A non-sex dominant linked domestic trait
Can I get brainliest :>?

how would you classify the bloody fingerprint found in the pedro ramon velasquez case?
patent
latent
delta
plastic

Answers

Answer:

patent

Explanation:

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

what is this pls help these are finals

Answers

Answer:

wowzerrrrrrs

Explanation:

what are the inputs and outputs of the reaction

Answers

Answer:

The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The cycle's output is an energy-rich sugar molecule. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH.

Explanation:

The light reactions, which occur during photosynthesis, have specific inputs and outputs. The inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

Light energy is absorbed by the chlorophyll pigments in the thylakoid membranes, while water molecules serve as a source of electrons for the photosynthetic electron transport chain.

ATP is a high-energy molecule that serves as the primary energy source for cellular processes. NADPH is a coenzyme that carries energized electrons and plays a role in the synthesis of carbohydrates during the subsequent dark reactions of photosynthesis. Molecular oxygen is a byproduct of light reactions and is released into the atmosphere as a waste product. Together, these outputs provide the energy and reduce the power needed for the synthesis of organic molecules during photosynthesis.

Therefore, the inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.

For more details regarding light reactions, visit:

https://brainly.com/question/13349357

#SPJ6

The plates include the lithosphere under the oceans true or false

Answers

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere. So i think its True

Who were the representatives
sent to work on the deal?

Answers

Answer:

Peace Negotiations

After Yorktown, the Continental Congress appointed a small group of statesmen to travel to Europe and negotiate a peace treaty with the British: John Adams, Benjamin Franklin, John Jay, Thomas Jefferson and Henry Laurens.

Who is the inventor of the modern classification system?

Answers

Answer:

Carolus Linnaeus

Explanation:

Answer:

Carolus Linnaeus

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

struggling in bio h e l p

Answers

Answer:

d maybe but im still figuring it  out

Explanation:

Answer:

D

Explanation:

What is a natural source of CO2

Answers

Answer:

venting volcanoes

Explanation:

NEED HELP ASAP!!!! Explain why the fact that invasive species did not co-evolve with the native species unbalances an ecosystem.

Answers

Answer: The invasive species unbalance an ecosystem because it takes over an ecosystem and does not let the other native species thrive while it takes over. There are many invasive species around the world even in your own town or state there is a type of fish suppose that is an invasive species to Michigan called a sea lamprey which kills fish native  to the great lakes and is taking over there are also zebra muscles if you need another example

BRAINLIEST PLZ

            Invasive species lack native species' population controls, such as predators, because they did not co-evolve with the other species in the ecosystem. As a result, the population of an invasive species may spread unchecked and eventually throw an ecosystem out of balance.

Unbalances in ecosystem :

                 A natural or human-caused disruption that throws off an ecosystem's natural balance is known as an ecological imbalance. Both natural and man-made disturbances have the potential to upset an ecosystem's delicate balance. A species' extinction or the introduction of a new species may cause an ecosystem to become ecologically unbalanced.

                 All the organisms and the physical setting they interact with make up an ecosystem. The nutrition cycles and energy flows connect these biotic and abiotic elements. Photosynthesis is how energy enters the system and is absorbed by plant tissue. Both internal and external influences influence ecosystems. External variables that do not directly affect an ecosystem, such as topography, parent material that creates the soil, and climate, control the ecosystem's general structure. For instance, decomposition, root competition, shade, disturbance, succession, and the kinds of species present all regulate internal variables. While the availability of these resources within the ecosystem is normally governed by internal factors, the resource inputs are often controlled by external activities. As a result, interior variables influence ecological processes as well as being influenced by them.

To learn more about ecosystem refer :

https://brainly.com/question/842527

#SPJ2

PLZ HELP ASAP WILL GIVE BRAINLIST!

Pick all the differences between prokaryotic (bacteria) and eukaryotic (animals,
plants, fungi) cells.

Prokaryotic cells do NOT have membrane bound organelles.

Eukaryotic cells do NOT have membrane bound organelles.

Prokaryotic cells do NOT have a nucleus.

Eukaryotic cells do NOT have a nucleus.

Answers

Answer:

Prokaryotes are organisms that consist of a single prokaryotic cell. Eukaryotic cells are found in plants, animals, fungi, and protists. They range from 10–100 μm in diameter, and their DNA is contained within a membrane-bound nucleus. Eukaryotes are organisms containing eukaryotic cells.

Explanation:

Answer: B

Explanation:

what was the problem with reusing contaminated water from other parts of the mill to extinguish the coke fires? From the book ‘When smoke ran like water’

Answers

Answer:

1. The problem with that was that the already poisonous water was made worse after using it to quench the flames from coke production.

2. It contaminated the soil, making it difficult for plants to grow.

Explanation:

As the author described the last stages of coke production, she explained that water was needed to quench the very hot flames from coke production. A 'bright fellow' suggested using dirty water from other parts of the mill to quench the flames from the coke production. The problems with this were;

1. The already contaminated water was made worse after it was used to quench the flames from coke.

2. Mrs. LaMendola noted that she was unable to grow her tomatoes in the path where the plumes from the oven ran. So the contaminated water negatively affected the soil.

The problem that should be already poisonous water is also made worse when it quenches the flames at the time when the production of the coke should be done.

Also, it contaminated the soil also it is difficult for growing the plants.

The problem of reusing contaminated water:

Since the author explained the last coke production stage so here the water required to quench that it should be very hot flames arise from the coke production. Also, the contaminated water should be worse whenever it is used for quenching the flames. Also, the contaminated water does not positively impact the soil.

Learn more about water here: https://brainly.com/question/18850280

Cells reproduce by splitting in half a process called cell division what do you cells need between divisions to make sure that they don’t get smaller and smaller

Answers

A cell must grow and the DNA must be copied so there is a full set of DNA to pass on to the daughter cells

CELLULAR RESPIRATION!!!

Explain what cellular respiration is using the vocabulary words: cellular respiration, energy, matter, and chemical reaction. Make sure to describe how the cell gets the matter and energy needed.

Answers

This so easy ,use google translate

Why must an organism be able to adjust to changing environments?

Answers

Answer:

blabkkbkkbcqcwwcqwqwwq

Explanation:

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space.

What makes something a compound microscope

Answers

Answer:

A compound microscope is an upright microscope that uses two sets of lenses (a compound lens system) to obtain higher magnification than a stereo microscope. A compound microscope provides a two-dimensional image, while a stereo microscope provides a three-dimensional image.  

Explanation:

COMPOUND MICROSCOPES are so called because they are designed with a compound lens system. The objective lens provides the primary magnification which is compounded (multiplied) by the ocular lens (eyepiece). ... Eyepieces are commonly 10x resulting in total magnifications of 40x to 1000x (Objective x Eyepiece).

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

ASAP?!!!!!!!!!!!!
IMAGE IS ATTACHED

What is the genotype ratio for this cross?
What is the phenotype ratio for this cross?

Answers

Answer:

If I'm not mistaken, the genotype ratio should be 1:2:1 and the phenotype ratio should be 3:1

Explanation:

Genotypic Ratios and Phenotypic Ratios for Punnett Squares on Y*uT*be

Other Questions
1) Describe the process of osmosis 2)What is ostmotic pressure?3)Describe the importance of a semipermeable membrane in osmosis?4)Explain the connection between isotonic solutions and osmosis5)Why is osmosis referred to as an example of facilitate diffusion?ANSWER THESE CORRECTLY AND YOU WILL GET 55 points! How have human systems and political systems shaped Northern Europe? My cat stared curiously at the toy truck.O prepositionO conjunctionO interjectionO adverb Topic: Importance and Impact of the scientific revolution What are the main ideas? What do I know about this topic? (at least 7 descriptions)*AP world history* The number of boys is 3/5 of the number of girls. If there are 120 children all together, how many boys are there? PLEASE HELP ME!!!!!!!! sanders found 6/7 of a pie in the fridge. he eats 1/3 and gives 1/2 to sister. How much is left This is a wave. What two senses use waves? rewrite the numbers in order from leastto greatest. -45/10, 3/1000, -0.005, 0.34 it is best to eat within an our of exercising? Identify the points after a 90 degrees clockwise rotation: A (5, -9) B (3, 1) C(-10, -10) how is starch formed (like the detailed explanation) and how is it digested by the animal 18 55 -101 196 55 18 22 X-22 57 88Calculate the missing data value X from the given average (arithmetic mean) of 38 and the known data values in the table.A)-38B) the -320D32E38Statistics and Probability 18% of the cars in the parking lot are blue. If there are 150 cars in the parking lot , how many cars are blue ? Which work was Poe's first big success?"The Tell Tale Heart""The Fall of the House of Usher""The Raven"" The Pit and the Pendulum" What were the social impacts of the green revolution? A clothing store used the sign shown below to advertise a discount on shirts,DISCOUNTBuy Two ShirtsGet 50% Off Third ShirtCelia wants to buy three shirts, which were originally priced $56 each. The store willdiscount the price of the third shirt and then apply a 7% tax to the total cost of allthree shirts. Including the tax, what will be the mean cost of each shirt? (Round youranswer to the nearest cent).Including the tax, the mean cost of each shirt is $ As a rule, only about 75% of properly planted seedlings will survive. Based on this rule, if a landowner plants 2500 seedlings properly, how many of these seedling should survive? A. 2575 B. 1875 C. 625 D. 2425 10. Which of the following does not contribute to changes in visual acuity?A. height/weightB. changes in the shape of the lensC. ageD. heredity How do I fix unidentified network Windows 10 Ethernet? No answer needed, just want to get rid of points. find m1 in parallelogram ABCD.