o. Find the domain and range of each of the three restricted functions.
Type your response here:
Domain
(restricted)
Function
Range
I
f(x)=sin(x)
f(x) = cos(x)
f(x) =tan(x)

O. Find The Domain And Range Of Each Of The Three Restricted Functions.Type Your Response Here:Domain(restricted)FunctionRangeIf(x)=sin(x)f(x)

Answers

Answer 1

The domain and range of the functions sin x, cos x, and tan x will be (-∞, ∞) and [-1, 1], (-∞, ∞) and [-1, 1], and R - (2n + 1)π/2 and (-∞, ∞) respectively.

What are domain and range?

The domain means all the possible values of x and the range means all the possible values of y.

The three restricted functions are given below.

f(x) = sin (x)

f(x) = cos (x)

f(x) = tan (x)

Then the domain of the three restricted functions will be

The domain of sin x will be (-∞, ∞).

The domain of cos x will be (-∞, ∞).

The domain of tan x will be R - (2n + 1)π/2.

Then the range of the three restricted functions will be

The range of sin x will be [-1, 1].

The range of cos x will be [-1, 1].

The range of tan x will be (-∞, ∞).

The graph is given below.

More about the domain and range link is given below.

https://brainly.com/question/12208715

#SPJ1

O. Find The Domain And Range Of Each Of The Three Restricted Functions.Type Your Response Here:Domain(restricted)FunctionRangeIf(x)=sin(x)f(x)

Related Questions

a computer purchased for $2 500 and its value depreciates at 5% per month. a).write the equation that models the situation. explain what each equation represent. b) determine the value of the computer after 2 years. c) in which month after it is purchased does the computer's worth fall below $1 000?

Answers

Answer:

a(y=-5x+2500) b(2,380) c(25months)

Step-by-step explanation:

someone point out if I'm wrong. I'm not so sure about "c".

(how I got b)

So 2 years=24 months

y=-5x+2500

So x would be 24.

-5(24)+2500

-120+2500

2,380

Which is more, 20 inches or 1 foot?

Answers

Answer:

20 inches

Step-by-step explanation:

there is only 12 inches in a foot

Drag the tiles to the boxes to form correct pairs. Not all tiles will be used. Match the pairs of polynomials to their products. (xy + 9y + 2) and (xy – 3) x2y2 + 3x2y – 7xy – 27x – 18 (2xy + x + y) and (3xy2 – y) 6x2y3 – 2xy2 + 3x2y2 – xy + 3xy3 – y2 (x – y) and (x + 3y) x3y + 3x2 + 3x2y2 + 7xy – 6 (xy + 3x + 2) and (xy – 9) x2 – 9y2 (x2 + 3xy – 2) and (xy + 3) (x + 3y) and (x – 3y)

Answers

The products of the polynomials are:

(xy + 9y + 2) * (xy - 3) = x²y² - xy + 9xy² - 27y - 6(2xy + x + y) * (3xy² - y) = 6x²y³ - 2xy² + 3x²y² -xy + 3xy³- y²(x - y) * (x + 3y) = x² + 2xy + 3y²(xy + 3x + 2) * (xy – 9)  = x²y² - 7xy + 3x²y - 27x  - 18(x² + 3xy - 2) * (xy + 3)  = x³y + 3x² + 3x²y² + 7xy - 6(x + 3y) * (x – 3y) = x² - 9y²

How to evaluate the products?

To do this, we multiply each pair of polynomial as follows:

Pair 1: (xy + 9y + 2) and (xy – 3)

(xy + 9y + 2) * (xy - 3)

Expand

(xy + 9y + 2) * (xy - 3) = x²y² - 3xy + 9xy² - 27y + 2xy - 6

Evaluate the like terms

(xy + 9y + 2) * (xy - 3) = x²y² - xy + 9xy² - 27y - 6

Pair 2: (2xy + x + y) and (3xy² - y)

(2xy + x + y) * (3xy² - y)

Expand

(2xy + x + y) * (3xy² - y) = 6x²y³ - 2xy² + 3x²y² -xy + 3xy³- y²

Pair 3: (x – y) and (x + 3y)

(x - y) * (x + 3y)

Expand

(x - y) * (x + 3y) = x² + 3xy - yx + 3y²

Evaluate the like terms

(x - y) * (x + 3y) = x² + 2xy + 3y²

Pair 4: (xy + 3x + 2) and (xy – 9)

(xy + 3x + 2) * (xy – 9)

Expand

(xy + 3x + 2) * (xy – 9)  = x²y² - 9xy + 3x²y - 27x + 2xy - 18

Evaluate the like terms

(xy + 3x + 2) * (xy – 9)  = x²y² - 7xy + 3x²y - 27x  - 18

Pair 5: (x² + 3xy - 2) and (xy + 3)

(x² + 3xy - 2) * (xy + 3)

Expand

(x² + 3xy - 2) * (xy + 3)  = x³y + 3x² + 3x²y² + 9xy - 2xy - 6

Evaluate the like terms

(x² + 3xy - 2) * (xy + 3)  = x³y + 3x² + 3x²y² + 7xy - 6

Pair 6: (x + 3y) and (x – 3y)

(x + 3y) * (x – 3y)

Apply the difference of two squares

(x + 3y) * (x – 3y) = x² - 9y²

Read more about polynomials at:

https://brainly.com/question/4142886

#SPJ1

DO,K = (9, 6) (3, 2) The scale factor is

Answers

Using proportions, it is found that the scale factor of the transformation is of 1/3.

What is a proportion?

A proportion is a fraction of a total amount, and the measures are related using a rule of three.

In this problem, during the transformation, each coordinate was divided by 3, hence, applying the proportion, the scale factor of the transformation is of 1/3.

More can be learned about proportions at https://brainly.com/question/24372153

#SPJ1

Mrs cunningham wants to use rubber tiles to cover the floor of an indoor playground
what is the unit cost per ruber tile

Answers

Answer:

the unit cost per rubber tile is $$$$$$$$$$$$$6

Step-by-step explanation:

..

Coach Sloan is responsible for recruiting male athletes to join the European
Masters track and field team. To improve his recruitment strategies, he wants to
investigate the connection between an athlete's height and 3000-meter run time.
Coach Sloan has recorded the heights of the men on the track and field team (in
centimeters), x, and their best 3000-meter times (in minutes), y.
The least squares regression line of this data set is:
y = -0.081x + 21.412
How quickly does this line predict a man who is 166 centimeters tall would run the 3000-
meters?
Round your answer to the nearest thousandth.
minutes

Answers

Using the line of best fit, it is found that the projected time for a man who is 166 cm tall is of 7.966 minutes.

What does the line of best fit gives?

It gives the project time in minutes to run the 3000 meters for a men of a height of x centimeters, according to the following function:

y = -0.081x + 21.412.

Hence, for a men of 166 centimeters, x = 166 and the projected time in minutes is given as follows.

y = -0.081(166) + 21.412 = 7.966.

More can be learned about line of best fit at https://brainly.com/question/17261411

#SPJ1

HELP ASAP

Find the volume of the sphere. Round your answer to the nearest tenth.

Answers

Answer:

V = 3053.63 mm^3

Step-by-step explanation:

radius : 9mm

V = 4/3 * pi * r^3

V = 4/3 * (3.1415926535898...) * 9^3

V = 3053.63 mm^3

4(x − 3) + 5x − x² for x = 2

Answers

Answer:

2

Step-by-step explanation:

Start by simplifying the expression:

[tex]4(x-3)+5x-x^2[/tex]

Use distribution:

[tex]4x-4(3)+5x-x^2\\4x-12+5x-x^2[/tex]

Add like terms:

[tex]9x-12-x^2[/tex]

Now, substitute the given value of x into the expression:

[tex]9(2)-12-2^2\\18-12-4\\6-4\\2[/tex]

Answer:

2

Step-by-step explanation:

Given: 4(x − 3) + 5x − x²

x = 2

Substitute 2 for the value of x in the expression and simplify:

➜ 4(2 − 3) + 5(2) − (2)²

➜ 4(−1) + 10 − 4

➜ -4 + 10 - 4

2

Therefore, the value of the expression when x equals 2 is 2.

Learn more here:

brainly.com/question/26860222

It’s confusing, would the answer be square root 7 over 4?

Answers

Answer:

[tex]\tan U = 1[/tex]

Step-by-step explanation:

[tex]\text{Apply Pythagorean theorem,}\\\\~~~~~~\text{Hypotenuse}^2 = \text{Base}^2 + \text{Perpendicular}^2\\\\\implies UT^2 = UV^2 +VT^2\\\\\implies UV^2 = UT^2 -VT^2\\\\\implies UV^2 = \left(7\sqrt 2 \right)^2 - 7^2\\\\\implies UV^2 = 49(2)-49\\\\\implies UV^2 = 49\\\\\implies UV = \sqrt{49} \\\\ \implies UV = 7[/tex]

[tex]\text{Now,}\\\\~~~~~~~~\tan \theta = \dfrac{\text{Perpendicular}}{\text{Base}}\\\\\\\implies \tan U = \dfrac{7}{7}\\\\\\\implies \tan U = 1[/tex]

Use the euclidean algorithm to find integers $x$ and $y$ such that $164x + 37y = 1,$ with the smallest possible positive value of $x$. state your answer as a list with $x$ first and $y$ second, separated by a comma.

Answers

Well, let's use the Euclidean algorithm:

164 = 4×37 + 16

37 = 2×16 + 5

16 = 3×5 + 1

Then working backwards,

1 = 16 - 3×5

1 = 16 - 3×(37 - 2×16) = 7×16 - 3×37

1 = 7×(164 - 4×37) - 3×37 = 7×164 - 31×37

so that x = 7 and y = -31.

5• (4 • x ) simplified

Answers

Step-by-step explanation:

= 5 • ( 4• x )

= 5 ( 4x )

= 20x

[tex]...[/tex]

Which graph does not represent a function of x?

Answers

c because it does not touch the y axis

NEED HELP QUICK DUE TMR MEAN AND MEDIAN

Answers

For 8. The answer is 5.
9. The answer is 27
10. The answer is 3
And for 11. The answer is 2.

If you want me to explain how I got those answers let me know. Hope this helps.

13. (a) In any triangle ABC, if C = 300,b= 4, a = 2 find A and B. [3] (b) If a = b = c and a,b,c are in G.P., show that x,y,z are in H.P. [2]

please, solve them ​

Answers

Step-by-step explanation:

oksosjaoqkqeand

[tex]66 \sqrt[3x9 \frac{ \sqrt[xx. \sqrt[36 \sqrt[3136(2 > kaki \: kwl{]{?} ]{?} ]{?} }{?} ]{?} [/tex]

Nine with two make 11

Round 4/15 to the nearest thousandth

Answers

Answer:

0.267

Step-by-step explanation:

4/15 as a decimal is 0.26 repeating so rounded to the nearest thousandth would be 0.267

Sally learnt how to fix boxes using nails from her father. 4 nails are needed to set up a box. Sally bought 692 nails and had 200 nails left after setting up some boxes. How many boxes did Sally set up?

Answers

Answer:

Step-by-step explanation:

Answer: 123 boxes

Step-by-step explanation:

Find how many nails she used.

692-200=492

she used 492 nails

we know that 4 nails are needed to set up a box

so we divide.

492/4=123

Sally set up 123 boxes

kelly has read 5/6 of a book helen has read 9/12 of the same book who read more of the book?

Answers

Answer:

Kelly has read more of the book

Type the correct answer in the box.

b
b
In the figure, a square is inside another bigger square.
If a=4 units and b=3 units, the length of the diagonal of the outside square rounded to the nearest tenth is
Inside square rounded to the nearest tenth is
units.
units and the length of the diagonal of the

Answers

Answer:

5.7 and 4.2

Step-by-step explanation:

Outside diagonal = √a² + a² = √4² + 4² = 4√2

= 5.7

Inside diagonal = √b² + b² = √3² + 3² = 3√2

= 4.2

Find the greatest common factor of 15x2y³ and -18x³yz.

Answers

Answer:

GCF=3[tex]x^{2}y[/tex]

Step-by-step explanation:

First, take a look at the numbers.

GCF of 15 and -18 = 3

Then, look at the variables.

GCF of (x^2)(y^3) and (x^3)(y)(z) = (x^2)(y)

Lastly, combine the two expressions

GCF = 3(x^2)(y)

Answer: 3(x^2)(y)

Hope this helps!

In two or more complete sentences, describe how to use technology to construct an appropriate regression model for the given data. you are not required to find the model, just choose the appropriate regression and explain how to use the technology. (-2,11), (1,1.7), (2,-0.2), (3,-1.5), (5,-2.3), (6,-1.8), (8,1)

Answers

The regression equation of the data values is y = 0.3x^2 - 2.8x +4.2

How to determine the regression equation?

Using a technology such as a graphing calculator, we simply input the data values in the graphing calculator and then wait for the result.

The x coordinates must be entered into the x values and the y coordinates must be entered into the y values

Using a graphing technology, the regression equation of the data values is y = 0.3x^2 - 2.8x +4.2

Read more about regression equations at:

https://brainly.com/question/17844286

#SPJ1

What is the range of the function on the graph?

Answers

Answer:

2

Step-by-step explanation:

because (x,y)=(1,2)

Therefore, domine(d)=(x)=1

And, range(r)=(y)=2

So the ans is 2

What is the value of x in the figure?
X
40⁰
OA. 40°
OB. 70°
OC. 80°
OD. 120°
OE. 150°
70⁰

Answers

Answer:

E 150

Step-by-step explanation:

The coordinates of the mid - point of the line AB is (-1, -5).

What is mid - point?

A midpoint is a point that divides a given line into two equal parts.

Given is that AB has endpoints at A(4, -8) and B(-6, -2). It is asked to find the coordinates of the midpoint of AB.

We can write the coordinates of the midpoint of AB as -

{x} = (x₁ + x₂)/2

{x} = (4 - 6)/2

{x} = - 2/2

{x} = -1

{y} = (y₁ + y₂)/2

{y} = (-8 - 2)/2

{y} = - 10/2

{y} = - 5

Therefore, the coordinates of the mid - point of the line AB is (-1, -5).

To solve more questions on mid-points, visit the link below-

https://brainly.com/question/17079522

#SPJ7

To increase sales, an online clothing store began giving a 50% off coupon to random customers. Customers didn't know whether they would receive the coupon until after the final sale. The website claimed that one in five customers received the coupon. Six customers each made purchases from the website. Let X = the number of customers that received the 50% off coupon.

Answers

To increase sales, an online clothing store began giving a 50% off coupon to random customers Six customers each made purchases from the website the binomial random variable and  mean and standard deviation of X  is mathematically given as

[tex]X ~ Bin(n = 6, p = 0.2)[/tex]

x= 0.9798

What is a binomial random variable?

Generally, the equation for is mathematically given as

P(coupon) = 1/5

P(coupon)= 0.2

the binomial distribution

[tex]X ~ Bin(n = 6, p = 0.2)[/tex]

Therefore, The mean and standard deviation of X

[tex]пВ = np \\np= 6* 0.2 = 1.2\\[/tex]

[tex]x=\sqrt{ np(1 - p)} \\ x=\sqrt{ 6 * 0.2 + (1 -0.2)} \\[/tex]

x= 0.9798

In conclusion, mean and standard deviation of X

x= 0.9798

Read more about binomial

https://brainly.com/question/3560614

#SPJ1

Question 5(Multiple Choice Worth 2 points)
(02.04 MC)
For the function f(x) = 3(x - 1)² + 2, identify the vertex, domain, and range.

Answers

Answer:

For the function f(x) = 3(x − 1)2 + 2, identify the vertex, domain, and range

Step-by-step explanation:

The vertex is (1, 2), the domain is all real numbers, and the range is y ≥ 2.

The vertex is (1, 2), the domain is all real numbers, and the range is y ≤ 2.

The vertex is (–1, 2), the domain is all real numbers, and the range is y ≥ 2.

Answer:

see explanation

Step-by-step explanation:

the equation of a parabola in vertex form is

f(x) = a(x - h)² + k

where (h, k ) are the coordinates of the vertex and a is a multiplier

f(x) = 3(x - 1)² + 2 ← is in vertex form

with vertex = (1, 2 )

The domain of a parabola exists for all real values of x

domain : x ∈ R

the range of the parabola are the values of y from the y- coordinate of the vertex, upwards.

range : y ≥ 2

Order the numbers from least to greatest. 0.35, 3/5 , 38%
Least # _________ U, _________ I, _________ N Greatest #

Answers

Answer:

.35 < 38% < 3/5

Step-by-step explanation:

.35 is the same as 35 percent which is less than 38, and 3/5 when divides is .60 turned into percent is 60 percent

3500 people attended a baseball game. 1330 of the people attending supported the home team, while 2170 supported the visiting team. what percentage of people attending supported the home team?

Answers

Answer:

38% is your answer boss. hope that helps :)

The percentage of people who supported the home team is 38 %

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

The total number of people attending the baseball game = 3500 people

The number of people supporting the home team = 1300 people

The number of people supporting the visiting team is = 2170

Now , the equation will be

The percentage of people supporting the home team is = number of people supporting the home team / total number of people attending the baseball game

Now , the equation will be

The percentage of people supporting the home team is A = ( 1300 / 3500 ) x 100

The percentage of people supporting the home team is A = 0.38 x 100

The percentage of people supporting the home team is A = 38 %

Therefore , the value of A is 38 %

Hence , The percentage of people who supported the home team is 38 %

To learn more about equations click :

https://brainly.com/question/10413253

#SPJ2

what does it want me to put to 6 decimal places

Answers

They want you to solve the iterative process to a point where the value of x is greater than or equal to 6 decimal places.

What is an iterative process?

An iterative process is a mathematical approach that employs an initial value to build a series of improving estimated solutions for a problem, where the nth-term estimation is generated from the prior ones.

You're required to put the value of x₁ = -1 into the equation:

[tex]\mathbf{x_{n+1}= \dfrac{(x_n)^3-1}{4}}[/tex]

where, [tex]x_1 = -1[/tex]

So;

[tex]\mathbf{x_{2}= \dfrac{(-1)^3-1}{4}}[/tex]

[tex]\mathbf{x_{2}=-0.5}[/tex]

[tex]\mathbf{x_{3}= \dfrac{(-0.5)^3-1}{4}}[/tex]

[tex]\mathbf{x_{3}=-0.28125}[/tex]

[tex]\mathbf{x_{4}=\dfrac{(-0.28125)^3-1}{4}}[/tex]

[tex]\mathbf{x_{4}=-0.2555618286}[/tex]

x₄ ≅ -0.255562  ( to 6 decimal places)

Learn more about the iterative process here:
https://brainly.com/question/26995556

#SPJ1

PLEASE HELP ME!
The dimensions of a rectangular prism are shown below:
Length: 1 1/3 feet
Width: 1 foot
Height: 2 1 /3 feet
The lengths of the sides of a small cube are 1 over 3 foot each.
Part A: How many small cubes can be packed in the rectangular prism? Show your work. (5 points)
Part B: Use the answer obtained in part A to find the volume of the rectangular prism in terms of the small cube and a unit cube.

Answers

#Part A

L=1-1/3=4/3B=1H=2-1/3=7)3

Volume of rectanglular prism

4/3(1)(7/3)28/9ft³

Volume of one cube

side³(1/3)³1/27in³

Total cubes

28/9÷1/2728/9×2728(3)84cubes

#2

Volume=

No of cubes ×volume of 1 cube

84(1/27)28/9in³

Answer:

A)  84 cubes

B)  Volume = 4 x 3 x 7 = 84 small cubes

    [tex]\sf Volume=3 \frac{1}{9}\:\:ft^3[/tex]

Step-by-step explanation:

Part A

As the lengths of each side of the small cube are ¹/₃ ft each, to find the number cubes in the rectangular prism, first find how many thirds are in each dimension of the prism:

[tex]\sf Length=1 \frac{1}{3}\:ft=\dfrac{4}{3}\:ft=4\:thirds[/tex]

[tex]\sf Width=1 \:ft=\dfrac{3}{3}\:ft=3\:thirds[/tex]

[tex]\sf height=2 \frac{1}{3}\:ft=\dfrac{7}{3}\:ft=7\:thirds[/tex]

Now simply multiply the number of thirds:

Number of cubes in prism = 4 x 3 x 7 = 84

Part B

As we have already found the dimensions of the prism in terms of the number of cubes, the volume of the prism in terms of the small cube is:

⇒ Volume = 4 x 3 x 7 = 84 small cubes

To find the volume of the prism in ft³, calculate the actual volume of the small cube:

[tex]\textsf{Volume of small cube}=\sf \dfrac{1}{3} \times \dfrac{1}{3} \times \dfrac{1}{3}=\dfrac{1}{27}\:ft^3[/tex]

Now multiply the volume in terms of number of cubes by the actual volume of a cube:

[tex]\begin{aligned}\textsf{Volume} &= \sf \textsf{Volume in cubes} \times \textsf{Volume of cube in ft}^3\\\\& = \sf 84 \times \dfrac{1}{27}\:ft^3\\\\& =\sf \dfrac{84}{27}\:ft^3\\\\& =\sf 3\frac{1}{9}\:ft^3\end{aligned}[/tex]

According to this factor tree, which of the following statements is true?

Answers

Answer:

option c

Step-by-step explanation:

a) NOT TRUE

A composite number is a positive integer that can be formed by multiplying two smaller positive integers.

3 and 7 are not composite numbers because each of them can only be divided by one and itself

b) NOT TRUE

2 is also a prime number so 3 and 7 are not the only numbers

c) TRUE

All the number listed are prime numbers hence why they are all at the bottom of the tree (only have 1 and itself as factors)

d) NOT TRUE

21 is not a prime number. The number 21 is divisible by 1, 3, 7, 21. For a number to be classified as a prime number, it should have exactly two factors. Since 21 has more than two factors, i.e. 1, 3, 7, 21, it is not a prime number.

what’s the answer to this

Answers

Answer:

Step-by-step explanation:

(2,1) and (4,2) are on the line.

slope

[tex]=\frac{2-1}{4-2} =\frac{1}{2} \\[/tex]

eq. of line is

[tex]y-1=\frac{1}{2} (x-2)\\2y-2=x-2\\2y=x\\or \\x-2y=0\\[/tex]

in slope intercept form

[tex]y=\frac{1}{2} x[/tex]

Other Questions
You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4