Pls help me with the answer

Pls Help Me With The Answer

Answers

Answer 1

Answer:

I found out the answer, it's 2/3

Step-by-step explanation:

I hope that helped!


Related Questions

Graph
Y=3/4x - 1/2
Pleaseeeee help!!

Answers

I’m not 100% sure kind of a guess but I would x=2/3. Good luck
Ok let me help hope this works 3/4 x 1/2= 2/3

Please answer correctly !!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!!

Answers

Answer:

2.5

Step-by-step explanation:

Answer:

6 : 15 right? or do i have to simplify

Step-by-step explanation:

Please help !! Which statement best describes the data ?

Answers

Answer:

The correct statement is C.

Step-by-step explanation:

A boxplot, also known as a box and whisker plot is a method to demonstrate the distribution of a data-set based on the following 5 number summary,

1. Minimum (shown towards the left of the chart)

2. First Quartile (shown by the left-most line of the box)

3. Median (or the second quartile) (shown as a line in the center of the box)

4. Third Quartile (shown by the right-most line of the box)

5. Maximum (shown towards the right of the chart).

From the provided box plot it can be concluded that:

Minimum = 3First Quartile = 6Median = 9Third Quartile = 12Maximum = 15

The median is a quantity in statistics that points out where the mid-value of a data set is. Half of the data is less than the median and half is more than the median.

The median is 9, i.e. half of the data is less than 9 and half is more than 9.

The correct statement is C.

1. Over a 4-month period, among 30 people with bipolar disorder, patients who were given
a high dose (10g/day) of omega-3 fats from fish oil improved more than those given a
placebo. (Archives of General Psychiatry 56 (1999): 407)

Answers

Answer:

Over a 4-month period, among 30 people with bipolar disorder, patients who were given a high dose (10 g/day) of omega-3 fats from fish oil improved more than those given a placebo.

Step-by-step explanation:

Wanna chat add me as a friend OR COME TO Snap (ADAMBELAL839)

Please help me with this question.​

Answers

Answer:

Monica = 48.50

Samuel = 24.25

Kara = 17.25

Step-by-step explanation:

First you write equations as you are reading the text:

m = 2s ("Monica earned twice as much as Samuel")

s = k+7 ("Samual earned 7 more than Kara")

m = 48.50

Next, you convert these equations to solve for s and k respectively.

So, if m=2s, then s=m/2:

s = m/2 = 24.25

Likewise, if s=k+7, then k=s-7

k = s-7 = 17.25

The difference between greatest and least is 48.50 - 17.25 = 31.25

PLEASE HELP! BRAINLIEST to correct answer!!!

Answers

Answer:

What do you need help with?

Explanation:

There is no question
Um I don’t mean to take points but I don’t see a question, but I hope that you do get help! Also have a good night ☺️

How long is x? How long is y?

Answers

i cant see anything

Step-by-step explanation:

Answer:

yes

Step-by-step explanation:

Last year Anthony earned $24,000. After a brief lay-off this year, Anthony’s income is $18,500.


A.
30% increase


B.
30% decrease


C.
23% increase


D.
23% decrease

Answers

30% decrease because it’s all about subtract

first to answer gets brainlest <33

Answers

Awww man the other person answered before me :(

what is the slope of the line?

Answers

Answer:

No Solution

Step-by-step explanation:

Slope is rise/run

rise = 1

run = 0

you can't divide by 0 so no solution

Answer:

The slope of the line is undefined.

Step-by-step explanation:

The slope of a line is given by [tex](y_2-y_1)/(x_2-x_1)[/tex], where [tex](x_1, y_1)[/tex] and [tex](x_2, y_2)[/tex] are points on the line. Since this is a vertical line, [tex]x_2-x_1[/tex] will, however, be equal to zero. We cannot divide by zero, so the slope of the line is not defined.


What is the value of 10(4-7)/-(4-1)?
0-10
O 6
O 6
O 10

Answers

Answer:

10

Step-by-step explanation:

In a classroom of 20 students, 70% of them have brown eyes. If a teacher picks two students at random to pass out supplies, what is the probability he chooses two students without brown eyes?​

Answers

Answer:

6/20 can I get brainliest pleast

Step-by-step explanation:

[tex] \frac{70}{100} \times 20 = 14 \\ 20 - 14 = 6 \\ [/tex]

there is a chance that the teacher will pick a student without brown eyes 6/20 times

Cual es la respuesta


Alguien que me ayude

Answers

Answer:

yes because it goes through the origin and has a constant rate is the correct answer hope it helps you :)

Kaylee put $240.00 in a bank account that gains 25%
interest annually.
How much interest will be accumulated in a year?
S???
If Kaylee makes no withdrawals, how much money will be
in the account after a year?
$???

Answers

Answer:

S=720

Step-by-step explanation:

25$ of 240 =60

60×12months=720

look everyone, im sorry if i get questions incorrect i really love math, go on call me a nerd. yes i am one. im also the kid thats quiet in class and also has anxiety so if someone gets upset at me for doing something wrong just know im very srry and im trying to help the best i can with these. aome of these i try and havent even learned yet and i learn things from the answers and i know how to do it after. again im incredibly sorry for the incorrect answers especially in mathmatics IM IN ALGEBRA lol :D have a good day and good night also who perfers school than online distance learning i learn a whole lot more in school than online? anyone else?

Answers

Answer:

heyyy its alright we all make mistakes , the most important thing is that you tried, and learned so you can help others and yourself in the future :D all efforts are appreciated  

Step-by-step explanation:

i'm introverted so online school is epic for me

Answer:

Well I usually do bad in school

Step-by-step explanation:

A rocket is launched from a tower. The height of the rocket, y in feet, is related to the time after launch, x in seconds, by the given equation. Using this equation, find the maximum height reached by the rocket, to the nearest tenth of a foot. y=-16x^2+227x+109

Answers

Answer: y=914.1 feet max height

Step-by-step explanation:

the radius of the base of a cylinder is 10 centimeters, and urs height is 20 centimeters. a cone is used to fill the cylinder with water. the radius of the cone base is 5 centimeters, and it’s height is 10 centimeters the number of times one needs to use the completely fillies cone to completely fill the cylinder with water is

Answers

Answer:

The answer is 24 times

HELP! i'll give brainliest just please help me ;(

Answers

12. SAS
And 14 is either SAS or none. The rest are correct

Find the distance between (-2.8) and (11, 2). Round to the nearest hundredth 14.32 13.58 12.58 13.04 None of the other answers are correct​

Answers

Answer:

14.32

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Algebra II

Distance Formula: [tex]d = \sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

Step-by-step explanation:

Step 1: Define

Point (-2, 8)

Point (11, 2)

Step 2: Find distance d

Simply plug in the 2 coordinates into the distance formula to find distance d

Substitute [DF]:                     [tex]d = \sqrt{(11+2)^2+(2-8)^2}[/tex]Add/Subtract:                       [tex]d = \sqrt{(13)^2+(-6)^2}[/tex]Exponents:                            [tex]d = \sqrt{169+36}[/tex]Add:                                      [tex]d = \sqrt{205}[/tex]Evaluate:                               [tex]d = 14.3178[/tex]Round:                                  [tex]d \approx 14.32[/tex]

in the picture below solve for X

Answers

Answer:

x = 7

Step-by-step explanation:

-4 + 12x = 11x + 3

      - 11x     - 11x

-4 + x = 3

+ 4        + 4

x = 7

Why 27 is not a prime

Answers

Answer:

27 isn't a prime because of the fact that it can be divided by 27.

And for your information, Prime numbers are numbers that can't be divided by any number other than 1 and itself.

Hope it helps.

Hey there!

- Fact/Side note: A “Prime Number” is basically a number that is LARGER THAN one but it has about approximately 2 factors which it has to either be 1 or the number by itself.

Anyways, now that we broke down the definition better, we can ANSWER your question!

• Answer: The number “27” isn’t considered a prime number because it isn’t CAPABLE OF BEING to DIVIDE by 1 or itself.

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst:)

Sorry I didn't know what subject to put this in but Please help I really do need it u don't have to tho
Which fitness test measures the strength and flexibility of the lower back?
A.
Walk/Run test
B.
Curl ups
C.
Sit and Reach
D.
Trunk Lift

Answers

Answer:

Curl ups

Step-by-step explanation:

I'm not 100% sure, but it seems like the most logical answer to me.

Answer:

Trunk Lift

Step-by-step explanation:

25. Write an expression to represent the area of the shaded region in simplest form.
5x + 2
x + 7
3x - 1

Answers

Answer:

Step-by-step explanation:

To determine what the area of the shaded region is, simply find the area of the large rectangle and subtract the product from the smaller one.

Since they are polynomials. Multiply one binomial to the other and first obtain the product, before subtracting the product of the smaller rectangle.

(5x + 2)(3x - 1) - (x)(x + 7)

15x^2 - 5x + 6x - 2 - x^2 - 7

14x^2 + x - 9.

I believe this would be the solution in standard form.

Find the probability of the following situation.
A cooler contains thirteen sports drinks:
six lemon-lime and seven orange. Two of
the lemon-lime and four of the orange
drinks are cold. The others are still warm.
You randomly grab a bottle. It is orange
flavored or warm.

Answers

Answer:

11/13

Step-by-step explanation:

"six lemon-lime and seven orange"

"Two of  the lemon-lime and four of the orange  drinks are cold"

2 lemon-lime are cold

4 lemon-lime are warm

4 orange are cold

3 orange are warm

Total orange flavored: 7

Not orange warm: 4

orange or warm: 11

p(orange or warm) = 11/13

The probability of grabbing a bottle that is orange flavored or warm is [tex]\frac{11}{13}[/tex]

What is probability?

'Probability means possibility. It is a branch of mathematics that deals with the occurrence of a random event. The value is expressed from zero to one.'

According to the given problem,

Total number of drinks = 13

Number of lemon-lime drinks = 6

Number of orange drinks = 7

Number of drinks that are cold = 2 lemon-lime + 4 orange

                                                   = 6 drinks

Number of drinks still warm = 7

Probability = [tex]\frac{Number of possible events}{Total number of events}[/tex]

                  = [tex]\frac{7 + 4 }{13}[/tex] [ 7 + 4 because 7 are orange flavored and 4 lemon-lime              

                            drinks are warm.]

                   = [tex]\frac{11}{13}[/tex]

Hence, we can conclude, the probability of grabbing a bottle that is orange or warm is [tex]\frac{11}{13}[/tex].

Learn more about probability here:

https://brainly.com/question/11234923

#SPJ2

                             

Ethan works at an electronics store as a salesperson. Ethan earns a 5% commission on the total dollar amount of all phone sales he makes, and earns a 4% commission on all computer sales. Ethan had twice as much in computer sales as he had in phone sales and earned a total of $117 in commission. Write a system of equations that could be used to determine the dollar amount of phone sales Ethan made and the dollar amount of computer sales he made. Define the variables that you use to write the system.


Answers

Answer:

0.05x+0.04y=117

y=2x

where:

x is the amount of all phone sales

y is the amount of all computer sales

Step-by-step explanation:

From the information given, the first equation would indicate that the comission of all phone sales plus the comission from all computer sales would be equal to 117, which is:

0.05x+0.04y=117, where:

x is the amount of all phone sales

y is the amount of all computer sales

Also, the statement indicates that Ethan had twice as much in computer sales as he had in phone sales, which would be:

y=2x

Now, you can replace y=2x in the first equation and solve for x:

0.05x+0.04(2x)=117

0.05x+0.08x=117

0.13x=117

x=117/0.13

x=900

Finally, you can replace the value of x in y=2x to find the value of y:

y=2(900)

y=1800

plllllzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz helppppppp

Answers

Answer:

Its C

Step-by-step explanation:

All you have to do is divide 90.2 by 11

Answer:

c

Step-by-step explanation:

Hunter and his children went into a grocery store where they sell peaches for $1.75 each and mangos for $0.50 each. Hunter has $20 to spend and must buy at least 14 peaches and mangos altogether. Also, he must buy at least 4 peaches and no less than 12 mangos. If xx represents the number of peaches purchased and yy represents the number of mangos purchased, write and solve a system of inequalities graphically and determine one possible solution.

Answers

Answer: answer:   n ≤ -3 or n < -5

step-by-step explanation:

-5 + 2n ≥ -11 +5+5

2n ≥ -6 2/2 ≤ -6/2

n ≤ -3 -6 - 10n > 44

+6 +6-10n > 50 -10/-10 50/-10

n < -5

x/3-10=8

x/3=18

x=48

help me ohmygod plz this is due tonight. thanks :)

Answers

Answer:

Page 1

a) plane ABC or plane ABF (really any combo of A, C, B, and F since they all lie on the plane)

b) B, C, F

c) A or B (they both lie on the same line)

d) AC or BC or AB (all variations of the same line)

Page 2

1)perpendicular

2) perpendicular

3) parallel

Page 3

a) ∠RQS and ∠SQR

b)∠TQR and ∠RQT

c) point Q

Hope this helps :))

PLEASE ANSWER‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️

Answers

Answer:

x-intercept = 9 y-intercept = 5

Step-by-step explanation:

I NEED HELP ASAP IN THE PICTURE ABOVE

Answers

Answer:

Step-by-step explanation:

Even numbers are those that can be divided by 2.

3440 and 7802

Odd numbers are the rest

4893, 1451 and 6645

Smallest to largest

1451, 3440, 4893, 6645 and 7802

Sum of even numbers

3440+7802= 11242 divided by 2(there are only 2 numbers)

11242 ÷ 2 = 5621

Other Questions
What are all the secrets to the universe ? 25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named?