Tom looks out his window. Which observation includes a biotic factor of the ecosystem he is in.
A. It is raining.
B. There are worms on his sidewalk.
C. The water in his pond is higher than usual.
D. The clouds are darker than they had been a little earlier.

Answers

Answer 1

Answer:

B - There are worms on the sidewalk

Explanation:


Related Questions

An operon in E. coli called the Gua operon, encodes proteins responsible for guanine biosynthesis. Two genes, guaA and guaB are under the control of a single promoter and operator, similar to the arrangement in the lac and trp operons. A repressor protein, purR, binds to the operator. In what conditions (high guanine or low guanine) do you suppose this repressor binds to the operator? Do you consider this a "repressible" or "inducible" operon? 3 pts

Answers

Answer:

Hight guanine"Repressible" operon

Explanation:

An operon is a fragment of DNI with genes that encode for different proteins of metabolic vias. Operons are composed of a regulator gene (that codifies for the repressor), the operator region (that links with the repressor protein), and the promotor sequence (RNA polymerase recognizes the promotor where it begins the RNA synthesis).

The repressor deactivates the expression of a gene when binding the operator of that gene. This binding does not allow the production of mRNA, and hence, proteins that this molecule should synthesize.

This protein has a negative effect on genic expression impeding the transcription of RNA from DNA.

Operons might be inducible or repressible. When the operon is inactive, and a little inductor protein activates it, then the operon is inducible. On the contrary, the repressible operon is the one that is normally active, but the little corepressor protein inactivates it.

During high guanine concentration, the repressor protein must act to regulate the amount of guanine in the environment. Hence it links the operator of genes guaA and guaB to stop the biosynthesis. The operon was initially active, but then by the union of the repressor, it gets inactivated. This is a "repressible" operon.

ILL GIVE BRAINLIST


Darren used the following soil triangle to identify a sample of soil as sandy loam.

Soil texture triangle. Clay soil is approximately 45 percent or less sand, 50 percent or more clay, and 40 percent or less silt. Silty loam soil is approximately 50 percent or less sand, 30 percent or less clay, and 50 percent or more silt. Sandy clay soil is approximately 45 to 65 percent sand, 35 to 55 percent clay, and 25 percent or less silt. Sandy clay loam soil is approximately 45 to 80 percent sand, 20 to 35 percent clay, and 35 percent or less silt.

Which description of soil likely allowed Darren to make this identification?

Mostly large particles, with a gritty texture, 60% sand, 10% clay, and 30% silt
Mostly large particles, with a smooth texture, 40% sand, 50% clay, and 10% silt
Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt
Mostly small particles, with a smooth texture, 30% sand, 30% clay, and 40% silt

Answers

Answer: I'm not sure but i think it's Mostly small particles, with a smooth texture, 10% sand, 50% clay, and 40% silt

Explanation:

Soil Texture is defined as the proportion of sand, silt, and clay-sized particles, which make up the composition of the soil.

The description that matches Darren's identification is that most small particles, with a smooth texture, are 10% sand, 50% clay, and 40% silt.

The soil texture can be explained as:

1. Clay in soil texture refers to the mineral soil particles that are less than 0.2 millimeters in diameter. Clay soil is 40% or more clay, less than 45% sand, and less than 40% slit.

2. Silt in the soil texture has a high percentage of sand and it feels smooth, having smooth textures. This soil has a high percentage of clay.

3. Sand is the largest mineral particle, which consists of the coarsest particles. The particles feel gritty and have a diameter of about 0.05 to 0.002 mm.

Thus, the correct answer is Option C.

To know more about soil texture, refer to the following link:

https://brainly.com/question/8046058

In which form food is stored in the leaves? Comment

Answers

the answer is starch

Explanation:

food is stored in the leaf in form of starch in plants

name one human hormone that is produced by genetically modified bacteria​

Answers

Answer:

Insulin

Explanation:

I knew the answer, but I'm not really good at explaining these so I got a little help from google. -------- Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.

The two kinds of cells are Prokaryotes and Eukaryotes. How are they
different? *
O Prokaryotes have a nucleus.

OEukaryotes have a nucleus.

O Prokaryotes are plant cells

оThere is no difference.

Answers

Eukaryotes have nucleus and protaryotes have plant calls that’s the difference

SOMEONE PLZ HELP!!!!!!!!

Answers

A - Endoplasmic Reticulum.

Which of the following terms best describes the study of genes during the 1900s?
A. predictable
B. guarded
C. progressive
stagnant

Answers

The correct answer is C :)

SOMEONE PLZ HELP!!!!!!!!!

Answers

Answer:

Organelle :)

Explanation:

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

When does the Mitosis-promoting factor (MPF) Cyclin concentration decline during a typical cell cycle in clam eggs?

A. when the cells grow larger
B. when DNA is synthesized
C. when haploid gametes are produced
D. when the cell nucleus divides

Answers

Answer:

D

Explanation:

Answer:

D

When the cell nucleus divides

Explanation:

SOMEONE PLZ HELP ME, PLZ I WILL MARK BRAINLIEST

Answers

Answer:

All living things are composed of cells.

Cells are the basic units of structure and function for living things.

All cells come from pre-existing cells. Also, organisms grow by “adding on more cells” NOT by increasing the size of their cells.

Explanation:

Which of the following is an example of evolution that can be studied firsthand by
scientists while it happens (meaning that scientists have opportunities to perform
experiments and to measure the outcome)?
A) The gradual decent of whales from tetrapod (four-legged) land mammal
ancestors
B) A dog shedding its thick winter fur so that it can stay cooler in the summer
C) The acclimation of a person's body to the low oxygen atmosphere at high
altitudes
D) The development of antibiotic resistance in bacteria

Answers

Answer:

c.

Explanation:

The acclimation of a persons body to the low oxygen atmosphere at high altitudes

how did the settlers view panther when they came to north America

Answers

Answer:

They viewed the Panther with fear and set out on a mission to exterminate it.

Explanation:

The first Spanish conquistador to ever sight a Panther was Alvar Nunez Cabeza de Vaca in 1513. When he saw the panther which he referred to as a lion, he was fearful of the animal. He and other Europeans set out on a mission to exterminate all Panthers. This was also necessary as they had to clear the bushes for them to reside.

In 1821 when Florida officially became a part of the United States, and people had to relocate there, a $5 dollar bounty was placed on every Panther killed. The Panthers relocated farther into the wild. As of 1990, the population of the Panther was just around 50. Panthers have since been named an endangered species.

Carbon dioxide + Water + Sunlight -> Glucose + ?
Which of these is needed to complete this equation?
A Carbon
B Hydrogen
C Oxygen
D Nitrogen

Answers

Answer:

C. Oxygen

Explanation:

plant needed Carbon dioxide, water, and sunlight to produce Glucose and oxygen.

The answer is C. Oxygen

What effect with the enzymes have on the time to make 1 MG of product

Answers

Answer:

Decreases

Explanation:

Enzymes speed up chemical reactions so the product is made in less time

We find DNA on the ___, In every living cell that an organism owns
a. chromosomes
b. reproduction
c. mitosis

Answers

Answer:

A. Chromosomes

Explanation:

A Chromosome is some thing carrying genetic information in the form of genes.

We find DNA on the chromosomes, in every living cell that an organism owns. So, the correct option is A.

What is Chromosome?

The word chromosome comes from the Greek words for color (chroma) and body (soma). Chromosomes are so named because they are cell structures, or bodies, that are strongly stained by certain color dyes used in research.

Chromosomes are defined as structures found inside the nucleus of a cell that are organized into genes from proteins and DNA. Each cell normally has 23 pairs of chromosomes.

These are threadlike structures which are made of protein and a single molecule of DNA that serve to carry the genomic information from cell to cell.

Therefore, the correct option is A.

Learn more about Chromosomes, here:

https://brainly.com/question/10234301

#SPJ6

Las Vegas Natural History Museum

Define Museum.

Answers

Answer:

A museum is a location that contains historical art and artifacts.

Explanation:

I need to break free

I WANT TO BREAK FREE!!!!!!!!!!!!!

One factor that determines the amount of oxygen transferred from the lungs to the blood is
the total functional surface area of the respiratory membrane.
O True
O False

Answers

Answer:

true

Explanation:

Explain how photosynthesis and cellular respiration work together.

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?

Answers

Answer:

i’d say mitochondria

Explanation:

mitochondria is the “powerhouse of the cell”

List and describe the different types of connective tissue. What similarities and differences did you observe?

Answers

Answer:

There are three types of connective tissues, loose connective tissues, dense, and hyaline.

Explanation:

The difference between them is the composition of the extracellular matrix that surrounds the fibroblast, that is to say that in loose connective tissue, the function will be of support or filling, and the fibroblast is immersed in an extracellular matrix with a high content of water and proteins. collagen.

On the other hand, in dense connective tissue, the amount of collagen fibers is greater, the protein structure as well, and the interlacing between proteins is more complex, and they may also have the ability to calcify as in the case of bone tissue or cartilage.

Finally, we have the hyaline connective tissue, which is very rich in hyaluronic acid and is found in the joints forming the discs, which are shock absorbers and protectors from bone wear due to friction between surfaces, hyaluronic acid, proteinglycans and glycoproteins are the main protagonists of all connective tissues together with the fibroblast, but even more so in the hyaline connective.


What causes this change in fur color?

Answers

Hair dye does .jason doe doe did dows

Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat

Answers

Metals are malleable
Metals are ductile
Metals are good heat and electricity conductors
Metals lose electrons in reactions.

Answer:

2,3, and 5

Explanation:

got it right on edge

True or false?

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Answers

Answer:

True

Explanation:

Answer:

True

Explanation:

It is frequently quoted that upwards of 80% of our taste is made up by smell. So if you plug your nose and cover your eyes, the taste between an apple and onion should be indistinguishable. Potato's will also taste the same .

Clue 1:
a. DNA is made of nucleotides.
b. Protein is made of amino acids.
c. DNA is located exclusively in the nucleus.
d. Protein is synthesized exclusively in the cytoplasm.
1) What two problems does the transfer of information from DNA to protein need to overcome?
a.
b.

Answers

DNA is made of necleotides.

What do the dotted lines, indicated with the arrow, represent in the DNA model above?

The junctions of codons between individual strands
The bond between deoxyribose molecules and phosphates
The monomers that make up a polymer
The hydrogen bond between complimentary nucleotides

Answers

Answer:

The hydrogen bond between complimentary nucleotides.

Sasha is studying a rock formation for her science class. Every few days she goes outside to study the formation. The questions she is
investigating are shown.
• Did the rock freeze and
unfreeze?
• Are there any plants growing on
the rock?
• Did the rock change color?
What question is Sasha most likely trying to answer?
O A. What is the age of the rocks in the rock formation?
B. What type of rocks are found in the rock formation?
C What processes are weathering the rock formation?
D. What minerals are the hardest in the rock formation?

Answers

Answer:

ill say c

Explanation:

what makes stem cells different from cells in the body

Answers

Answer:

Stem cells are the body's raw materials

Explanation:

Stem cells are the body's raw materials — cells from which all other cells with specialized functions are generated. Under the right conditions in the body or a laboratory, stem cells divide to form more cells called daughter cells.

Stem cells are different from the other body cells as these are unspecialized cells which can undergo division and renew on their own. The stem cells can undergo specialization by the process of cellular differentiation.

What are Stem cells?

Stem cells can be defined as the body's raw materials. These are the cells from which all the other cells with specialized functions are generated.

Embryonic stem cells are the pluripotent stem cells derived from the inner cell mass of a blastocyst. Blastocyst is an early-stage pre-implantation embryo. Human embryos reach the blastocyst stage in 4 to 5 days post fertilization, at which time they consist of 50 to 150 cells.

Stem cells are different from the other cells in the body in three ways which are the stem cells can divide and renew themselves over a long time. Stem cells are unspecialized cells, so they cannot do specific functions in the body unless they undergo cellular differentiation. Stem cells have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells by undergoing cellular differentiation.

Learn more about Stem cells here:

https://brainly.com/question/25584485

#SPJ2

A 67-year-old was previously diagnosed with rheumatic heart disease. Tests now reveal lipoprotein deposition with chronic inflammation that impairs blood flow from the left ventricle into the aorta. Which diagnosis does this history support?

Answers

Answer:

Aortic stenosis

Explanation:

Aortic stenosis is one of the most common cardiovascular diseases. This disease is caused by the narrowing of the aortic valve opening, thereby restricting blood flow from the left ventricle to the aorta. Symptoms of aortic stenosis include, among others,  heart palpitations, swollen feet, chest pain, breathing difficulties, sleeping difficulties, chronic fatigue, etc. Aortic stenosis may be cured by transcatheter aortic valve replacement, which is a minimally invasive surgical technique that allows to replace the narrowed aortic valve.

Eukaryotic genomes have gene sequences that can code for more than one polypeptide sequence because _____.

Answers

Answer:

The  correct answer would be -A pre-mRNA becomes mRNA by cutting out different introns

Explanation:

During the process of the RNA splicing, pre-mRNA has several specific segments of sequence that are identified by the spliceosome and then removed from the pre-mRNA. Specific parts that are removed are known as introns and the parts that stuck to become mRNA are exons.

Gene sequences in the eukaryotic genome can code for more than one protein due to removing the different introns every time to become mRNA from pre mRNA.

Other Questions
i need it now Which statement from the passage BEST shows that David and Chan are committed to Tae Kwon Do?A.Following an elaborate series of patterned moves, Chan could execute high spinning kicks and break wood boards with his hands and feet.B.He had planned to skip International Night this year precisely because his cousins, Marjorie and Jamal, were making their once-a-year visit.C.Chans parents had taken him there to learn about his heritage; Davids mom had enrolled him because she needed him to be in some class or club after school . . . .D.Will your wrist be okay? David asked, thinking about the upcoming regional martial arts contest they had been training for. Can anyone help me please ?? What is the formula of Acceleration for mass and time As a nurse in a maternity ward, you are tracking the weights of newborn babies. In the month of August, 360 babies are born, with a mean weight of 8.1 pounds. In the month of September, 291 babies are born, with a mean weight of 7.8 pounds. what, approximately, is the mean weight for babies born during the two-month.? 7.83 pounds 7.93 pounds 7.95 pounds 7.97 pounds 7.99 pounds Where do convection currents occur?A.In areas with the same temperatureB.In areas with different air pressuresC.In areas with the same altitudeD.In areas with different cloud types How do I do this? Im lost Prohibition led to A. the Great MigrationB. Organized CrimeC. FundamentalismD. World War 1 Which of the following would be an example of an implicit cost?(i)forgone investment opportunities(ii)wages of workers(iii)raw materials costsGroup of answer choices Sydney loves people. Throughout high school, she volunteered at theRed Cross. During the summers, she worked at social serviceorganizations and saved for college. She has two years of college left,and she's out of money. She's going to a state school. Even so, thetwo-year tab for tuition, room, board and books is nearly $20,000. Shecan borrow that sum through low-interest student loan programs. Sheknows about Dave Ramsey and has asked you what he might advise herto do. Which are true about the Federalist Papers? (Select all that apply.)A- George Mason edited the newspaper that published the Federalist papersB- The Federalist Papers criticized the Constitution and led to its revisionC- The Federalist Papers responded to letters written by the anti-federalistsD- James Madison was an author of both the Constitution and the Federalist Papers What is the term used to describe the way the behavior of buyers and sellers affects the level of prices for goods and services, without government interference? Find the 87th term of the arithmetic sequence 12, 0, -12, Someone help Ill give brainlist lol Read this passage about Amelia Earhart.Amelia Earhart was born July 24, 1897, in Kansas. She was an adventurous and fun-loving child. That adventurous spirit remained as she grew older. One day in 1920, after going on a plane ride, she was determined to fly planes. She worked at any job she could find to save up for flying lessons, which cost $1,000. At one point, she worked as a nurses aid and a social worker. Six months after receiving flying lessons, Amelia bought her own plane, and she flew as high as 14,000 feet, which set a world record for female pilots. A short time afterward, Amelia became the sixteenth female to earn a pilots license. In 1928, an opportunity arose for Amelia to participate in a transatlantic flight across the Atlantic Ocean as a copilot. This experience later came in handy when she became the first woman to fly solo across the Atlantic in 1938. She received many honors for this achievement, such as the Distinguished Flying Cross from Congress.As Amelia approached her fortieth birthday, she was planning her biggest trip yet: She wanted to be the first woman to fly around the world. Of course, she needed a lot of help to make this happen. She made a first attempt that failed and damaged her plane. But Earhart was not one to give up, so she made another attempt at the ground-breaking mission. She did make some progress by flying 7,000 miles to New Guinea but did not make it to her next stop, Howland Island. Sadly, Earharts plane disappeared, and, despite search and rescue attempts, she was never found. To this day, Earhart is known and celebrated for her bravery, persistence, and commitment to aviation.Which sentence from the passage contains information that could best be used to create a yearbook blurb about Amelia Earhart?As Amelia approached her fortieth birthday, she was planning her biggest trip yet. Sadly, Earharts plane disappeared, and, despite search and rescue attempts, she was never found. One day in 1920, after going on a plane ride, she was determined to fly planes.Six months after receiving flying lessons, Amelia bought her own plane, and she flew as high as 14,000 feet, which set a world record for female pilots. A racecar is racing along a circular track. The car starts at the 3-o'clock position and travels CCW along the track. The car is constantly 8 feet from the center of the race track and travels at a constant speed and it takes the car 7.854 seconds to complete one full lap. a. How many radians does the car sweep out per second? radians per second Preview b. Write a function fthat determines the car's distance to the right of the center of the race track (in feet) in terms of the number of seconds t since the start of the race. f(t) Why are the no locks on the Suez Canal the answer is B. The elevation of the Red and Mediterranean Seas are about the same. ANSWER!! (DUE TMR) (THERE WILL BE MORE) (EASY QUESTIONS) does anyone like 4freakshow if so start a convo in comments 11-16 pleasee HELPWhich of the following was an Arab innovation? Papermaking Rockets Numerical notation Algebra A mixture of two gases with a total pressure of 2.00 atm contains 0.70 atm of Gas A. What is the partial pressure of Gas B in atm?