Two triangles are proportional, and the first triangle has a base of 10 cm and a height of 15 cm. If the base of the second triangle is 12 cm, what is the height of the second triangle?​

Answers

Answer 1

Answer: b1/b1=h1/h2=10/12=15/h2 so use criss cross and equel to 15×12=10h2 both sides devide by 10 and equel 180/10=18

so h2=18


Related Questions

I NEED HELP ASAP!!!


Amalia and Alec are studying the growth of a plant over time. They measure the height of the plant at the end of each week for several weeks and display the data in a scatter plot. They then find the equation for the best-fit line to be y=2.5 + 1.25rMULTIPLE CHOICE Question 7 Amalia and Alec are studying the growth of a plant over time. They measure the height of the plant at the end of each week for several weeks and display the data in a scatter plot. They then find the equation for the best-fit line to be y= 2.5 + 1.25x

X = the number of weeks that have passed


= the height of the plant
They want to use the equation to estimate when the height of the plant will be 10
Amalia's estimate is after 6 weeks.
Alec's estimate is after Week 15.
Is either student correct?

Answers

Amalia would be correct. They are guessing when the height would be 10, and you are given an equation that will 'predict' that. Height is y, so substitute 10 in the equation and solve for x. You will get x=6

Yes, Amalia is correct. If y=height of plant and x=number of weeks that have passed then you plug in the numbers, we are looking for height of 10 so y=10 so 10=2.5+1.25(6) is the equation if we plug in Amalias guess of 6 weeks, if we plug in Alexs guess it would be same but use his guess 15 instead of 6. So to figure out of the equation is correct I’ll replace 10 for y so I can do it out y=2.5+1.25(6) now easily solve for y by doing 1.25x6=7.5 then I add 2.5+7.5=10, so I plug 10 back in for y and it looks like 10=10 so yes she is right. But I double check by also doing the second students guess, right away I multiply 1.25x15 and I get a number larger than 10, I think it was 18 something so I know that’s wrong without even having to finish it by adding 2.5 because then it’ll only get bigger but for fun you add it say it’s 20.5 then plug 10 back in for y 10=20.5 nope they aren’t equal so answer is not right. If you want to guess for any other height, just plug it in for the y and your guess for number of weeks for x and do out the equation (I used a calculator to multiply since they aren’t whole numbers it’s easier to do 1.25x6 or whatever number on calculator I can’t do it in my head) and then just add 2.5 either with calculator or not it’s easy enough to do it in your head. Hope that helps.

Determine whether these two ratios make a proportion 5/9, 56/99. True or False

Answers

Answer: The answer is True .

The statement is false, these two ratios don't make a proportion.

What is ratio?

The ratio is defined as the comparison of two quantities of the same units that indicates how much of one quantity is present in the other quantity.

here, we have,

5/9, 56/99

we know, that, two ratios make a proportion if, a:b=c:d

but, here,

5/9= 5:9

56/99 = 56: 99

Hence, The statement is false, these two ratios don't make a proportion.

To learn more on ratio click:

brainly.com/question/13419413

#SPJ5

This is for a test please answer

Answers

Answer:

25 = b

26 = c

Step-by-step explanation:

Please help! I’m really confused on this question

Answers

Answer:

noncollinear

Step-by-step explanation:

my guess sorry if im wrong

quadrilateral ABCD with angle B of 72 degree, angle C of 130 degrees, angle D of 67 degrees What is the measure of ∠A?

Answers

Answer:

[tex]m\angle A = 91^{\circ}[/tex]

Step-by-step explanation:

All angles in a quadrilateral must add up to [tex]360^{\circ}[/tex], so [tex]\angle A + \angle B + \angle C + \angle D = 360^{\circ}[/tex]

We can now solve for [tex]\angle A[/tex] by substituting [tex]\angle B, \angle C, \angle D[/tex] for the correct values.

[tex]\angle A + \angle B + \angle C + \angle D = 360\\\angle A + 72 + 130 + 67 = 360\\\angle A + 269 = 360\\\\\boxed{\angle A = 91^{\circ}}[/tex]

That is the answer

- Kan Academy Advance

willams bought piece of woods that is 3 feet long.he cuts it in to two pieces.one piece is 14 in long how long is the other piece

Answers

Answer:

22 inches

Step-by-step explanation:

3 feet = 36 inches

36-14=22

The other half is 22 inches long

**Find the perimeter of the region.**
The circle are congruent to each other.

The circles are tangent to each other, and the straight
segments are tangent to the circles.

The straight
segments are 5 units long.

Answers

Find the perimeter of the region.**

The circle are congruent to each other.

The circles are tangent to each other, and the straight

segments are tangent to the circles.

The straight

segments are 5 units long

please help! easy! it is due right now!!

Answers

Answer:

3 Cups of flour.

Step-by-step explanation:

find 3 solutions for y=-2x-4

Answers

Three possible solutions for this equation would be (0, -4), (1, -2), and (2, 0).

Explanation:

Solving the equation would provide these three various answers to verify the equation is true.

what is the answer here

Answers

Answer:

120m²

Step-by-step explanation:

Area¹ = (6*5) = 30*2 surfaces = 60m²

Area² =(6*6) = 36m²

Area of Triangle =(1/2*4*6) = 12* 2 surfaces = 24m²

Total surface area = 60 + 36 + 24 = 120m²

=/120m²

the the radius of a sphere is 8 cm. find the volume. round off to nearest tenth if necessary. use 3.14 for pi​

Answers

given,

radius of sphere , r = 8cm
We know that,
Volume of sphere = 4/3 pi r^3 cubic units

=> Volume of sphere , V = 4/3 x 3.14 x 8 x 8 x 8

=> Volume of sphere , V = 2143.573 units

Rounding of to nearest tenth , V =2143.58 units
Given:Radius= 8 centimeters To find:

The volume of the given sphere.

Solution:

[tex]\large\boxed{Formula:V = \frac{4}{3} \pi {r}^{3}}[/tex]

[tex]\large\boxed{\red \pi \red = \red 3 \red . \red 1 \red 4}[/tex]

Let's solve

Substitute the values according to the formula.

[tex]V = \frac{4}{3} \times 3.14 \times {8}^{3} [/tex]

[tex]V = 2143.573333 \: {cm}^{3} [/tex]

[tex]\large\boxed{= 2143.6 \: {cm}^{3} \: (nearest \: tenth)}[/tex]

Hence, the volume of the given sphere is 2143.6 cubic centimeters.

If a tree grew 5 feet in n years, what was the average rate at which the tree grew, in inches per year?

Answers

Answer:

0.01

Step-by-step explanation:

so i divided 5 by 365 because 365 days or in a year so 5/365=0.01369863013 and usually just said as 0.01

Hope This Helped

Find the interquartile range (IQR) of the data in the dot plot below VV
(PLS HELP ME PLSSS)

Answers

The interquartile range of the data that is represented on the dot plot is: 2 chocolate chips.

What is the Interquartile Range?

Interquartile range (IQR) = upper quartile - lower quartile.

Upper quartile (Q3) = center of the second half of the data = 5

Lower quartile (Q1) = center of the first half of the data = 3

Interquartile range (IQR) = 5 - 3

Interquartile range (IQR) = 2 chocolate chips.

Learn more about the interquartile range on:

https://brainly.com/question/4102829

#SPJ1

Find the mean of the following data. (a) 9, 7, 11, 13, 2, 4, 5, 5 (b) 16, 18, 19, 21, 23, 23, 27, 29, 29, 35 (c) 2.2, 10.2, 14.7, 5.9, 4.9, 11.1, 10.5 (d) 11/4, 21/2, 51/2, 31/4, 21/2

Answers

Answer:

a) 7 b) 24 c) 8.5 d) 11.4 (i think)

Step-by-step explanation:

With full explanation from the internet like before
3x2-6x+5=0

Answers

Answer:

[tex]\sf x=1+i\sqrt{\dfrac{2}{3}} \ \quad and \quad \:x=1-i\sqrt{\dfrac{2}{3}}[/tex]

Explanation:

Given Expression:

3x² - 6x + 5 = 0

Use the Quadratic Formula:

[tex]\sf x = \dfrac{ -b \pm \sqrt{b^2 - 4ac}}{2a} \ \ when \ \ ax^2 + bx + c = 0[/tex]

insert coefficients

[tex]\Longrightarrow \sf x = \dfrac{-\left(-6\right)\pm \sqrt{\left(-6\right)^2-4\cdot \:3\cdot \:5}}{2\cdot \:3}[/tex]

[tex]\Longrightarrow \sf x = \dfrac{\left6\right\pm \sqrt{-24} }{6}[/tex]

[tex]\Longrightarrow \sf x = \dfrac{\left6\right\pm 2\sqrt{6}i}{6}[/tex]

[tex]\Longrightarrow \sf x =1 \pm i\dfrac{\sqrt{6} }{3}[/tex]

[tex]\Longrightarrow \sf x=1+i\sqrt{\dfrac{2}{3}}, \quad 1-i\sqrt{\dfrac{2}{3}}[/tex]

3x²-6x+5=0

Use quadratic formula

[tex]\\ \rm\Rrightarrow x=\dfrac{-b\pm\sqrt{b^2-4ac}}{2a}[/tex]

[tex]\\ \rm\Rrightarrow x=\dfrac{6\pm \sqrt{36-60}}{6}[/tex]

[tex]\\ \rm\Rrightarrow x=\dfrac{6\pm\sqrt{-24}}{6}[/tex]

[tex]\\ \rm\Rrightarrow x=\dfrac{6\pm2\sqrt{6}i}{6}[/tex]

[tex]\\ \rm\Rrightarrow x=1\pm \dfrac{sqrt{2}i}{\sqrt{3}}[/tex]

[tex]\\ \rm\Rrightarrow x=1\pm\sqrt{\dfrac{2}{3}}i[/tex]

Question 1 of 10
f(x) = 3x³ - 2x² + 4x - 5
g(x) = 6x - 7
Find (f + g)(x).

Answers

(f+g)(x)f(x)+g(x)3x³-2x²+4x-5+6x-73x³-2x²+4x+6x-5-73x³-2x²+10x-12

Done!

Answer:

[tex](f+g)(x)=3x^3-2x^2+10x-12[/tex]

Step-by-step explanation:

Given:

[tex]\begin{cases}f(x)=3x^3-2x^2+4x-5\\g(x)=6x-7 \end{cases}[/tex]

[tex]\begin{aligned}(f+g)(x) & = f(x)+g(x)\\& = (3x^3-2x^2+4x-5)+(6x-7)\\& = 3x^3-2x^2+4x-5+6x-7\\& = 3x^3-2x^2+4x+6x-5-7\\& = 3x^3-2x^2+10x-12\end{aligned}[/tex]

ten students in Ashton class were randomly selected and asked how many phone call they made yesterday their answer where 1,0,10,2,9,15,0 and 3 find the mean of the data find the median of the data find the mode of the data find the range of the data

Answers

Answer:

Mean = 2.2

Median = 1

Mode = 0 and 1

Range = 9

Step-by-step explanation:

First arrange the number of calls from least to greatest.

0, 0, 0, 1, 1, 1, 2, 3, 5, 9

Mean is the average. Add the numbers together and divide by 10 since there are 10 numbers in total.

0 + 0 + 0 + 1 + 1 + 1 + 2 + 3 + 5 + 9 = 22

22/10 = 2.2

Mean = 2.2

Median is the middle number. Since there is an even amount of numbers, take the 5 and 6 number in the list, add them together and divide by 2. You are taking the average of the two numbers.

0, 0, 0, 1, 1, 1, 2, 3, 5, 9

1 + 1 = 2

2/2 = 1

Median = 1

Mode is the number that occurs the most.

0, 0, 0, 1, 1, 1, 2, 3, 5, 9

In the list the numbers 0 and 1 both occur 3 times.

Mode = 0 and 1

Range is the biggest number (9) minus the smallest number (0).

0, 0, 0, 1, 1, 1, 2, 3, 5, 9

9 - 0 = 9

Range = 9

Fizer Pharmaceutical paid $78 million on January 2, 2021, for 6 million shares of Carne Cosmetics common stock. The investment represents a 25% interest in the net assets of Carne and gave Fizer the ability to exercise significant influence over Carne’s operations. Fizer received dividends of $2 per share on December 21, 2021, and Carne reported net income of $28 million for the year ended December 31, 2021. The fair value of Carne’s common stock at December 31, 2021, was $28.50 per share.
The book value of Carne's net assets was $192 million.
The fair value of Carne's depreciable assets exceeded their book value by $48 million. These assets had an average remaining useful life of twelve years.
The remainder of the excess of the cost of the investment over the book value of net assets purchased was attributable to goodwill.
Prepare the appropriate journal entries related to the investment during 2021. (If no entry is required for a transaction/event, select "No journal entry required" in the first account field. Enter your answers in millions, (i.e., 10,000,000 should be entered as 10).)

Answers

The appropriate journal entries related to the investment during 2021 is: Debit Investment in Carne shares $78 million; Credit Cash $78 million.

Journal entries

January 2, 2021

Debit Investment in Carne shares $78 million

Credit Cash $78 million

January 12, 2021

Debit Cash $12,000,000

($2 per shares  x 6,000,000)

Credit Investment in Carne shares  $12,000,000

December 21, 2021

Debit  Investment in Carne shares $7,000,000

Credit Investment revenue $7,000,000

(25% x $28,000,000)

December 31, 2021

Debit Investment revenue $1,000,000

Credit Investment in Carne shares $1,000,000

[25% x ($48,000,000 ÷ 12 years)]

December 31, 2021

No journal entry for changes in fair value when using equity method.

Therefore the appropriate journal entries related to the investment during 2021 is: Debit Investment in Carne shares $78 million; Credit Cash $78 million.

Lear more about journal entries here:https://brainly.com/question/14279491

#SPJ1

3(5z - 7) - 2 (9z - 11) = 4 (8z - 13) - 17

Answers

Answer z=2

See picture attached for the math

Which of the following solutions to the inequality -7x+14>-3x -6? Select all that apply
-10
10
-5
5
-3
3
0

Answers

I went thru it and im pretty sure that only these work

-10

-5

-3

A card is drawn from a deck of 52 cards what is the probability that it is a number 2?

Answers

Answer:

Step-by-step explanation:

Remark

The deck is divided into 4 different kinds of cards

clubs

diamonds

Hearts

Spades

Each kind of card has a 2

So there are 4 twos in a standard deck of cards.

Answer:

P(2) = 4/52P(2) = 1/13P(2) = 0.07692

The box plot shows the number of home runs hit by 43 players during a baseball season.
Which statement best describes the data?
The number of data values between the lower
quartile and the median is less than the
number of data values between the upper
quartile and the median.
2
9
15 19
28
The number of data values between the lower
quartile and the median is greater than the
number of data values between the upper
quartile and the median.
|++++++
0 4 8 12 16 20 24 28 32
The spread between the lower quartile and
the median is less than the spread between
the upper quartile and the median.
The spread between the lower quartile and

Answers

The statement fourth "The spread between the lower quartile and the median is greater than the spread between the upper quartile and the median" is correct.

What is the box and whisker plot?

A box and whisker plot is a method of abstracting a set of data that is approximated using an interval scale. It's also known as a box plot. These are primarily used to interpret data.

The box plot is missing.

The box plot is shown (please refer to attached picture)

The given options are:

The number of data values between the lower quartile and the median is less than the number of data values between the upper quartile and the median.The number of data values between the lower quartile and the median is greater than the number of data values between the upper quartile and the median.The spread between the lower quartile and the median is less than the spread between the upper quartile and the median.The spread between the lower quartile and the median is greater than the spread between the upper quartile and the median.

As we know the property of box plot the difference between the lower and higher quartiles is greater than the difference between the upper and lower quartiles.

The spread between the lower quartile and the median:

= 15 - 9 = 6

= 19 - 15 = 4

Thus, the statement fourth "The spread between the lower quartile and the median is greater than the spread between the upper quartile and the median" is correct.

Learn more about the box and whisker plot here:

brainly.com/question/3209282

#SPJ1


A dentist has 420 male and female patients that range in ages from 10 years old to 50 years old and up as shown in the table.
What is the experimental probability that the next patient will be female and in the age range 22-39?

Answers

The experimental probability that the next patient will be female and in the age range 22-39 is 56/420

What is the experimental probability?

Probability is the odds that a random event would happen. The odds usually lie between 0 and 1.

The experimental probability = number of female in the age range 22-39 / total number of patients

=  56/420

To learn more about experimental probability, please check: https://brainly.com/question/23722574

#SPJ1

Help asap immediately

Answers

[tex] \frac{9}{8 \: } = 1 \frac{1}{8} [/tex]

HOPE THIS HELPS :)

[tex] \sf \frac{9}{8} [/tex]

Step-by-step explanation:

[tex] \sf9 \div 8 = 1(1left)[/tex]

[tex]1 \frac{1}{8} [/tex]

#Hopethishelp

_______

Moumocl!

Solve for x
x/8 = 3/5 give your answer as an improper fraction in its simplest form

Answers

Answer:

24/5

Step-by-step explanation:

x is 4.8, improper simplified is 24/5

Jenna is a part-time receptionist at
the dentist's office. Her income last
year was $9,125. Her tax status is
single, she claims one exemption for
herself, and she plans on taking the
standard deduction. What is her
taxable income?

Answers

From the information provided, Jenna's taxable income is zero. See the explanation below.

How do you calculate taxable income?

The formula for taxable income is given as:

Gross Income Less Standard Deduction.

Since the current effective standard deduction for singles is $12,950 Jenna doesn't need to file a tax return since tax cannot be a negative figure.

it is to be noted that the rate payable for individual single taxpayers in 2022 is $10% up to $10,275.

Learn more about Taxable income at:
https://brainly.com/question/24732919
#SPJ1

Which expressions will help you find the surface area of this right triangular prism? Select all that apply.



38 × 45
1/2 × 36 × 45
45 × 36
1/2 × 36 × 38

Answers

38 is the bet one bcuz like it jus thick’s up with my mentala sun it like sucks sucks so bad someone

Sergio is creating a college fund for his son Diego, who is now 4 years old. Sergio put $1600 in a CD that will earn 8.25% simple interest. How much will be in the account when Diego turns 18?

Answers

well, Diego is 4 now, so by his 18th birthday that'll be 14 years later.

[tex]~~~~~~ \textit{Simple Interest Earned Amount} \\\\ A=P(1+rt)\qquad \begin{cases} A=\textit{accumulated amount}\\ P=\textit{original amount deposited}\dotfill & \$1600\\ r=rate\to 8.25\%\to \frac{8.25}{100}\dotfill &0.0825\\ t=years\dotfill &14 \end{cases} \\\\\\ A=1600[1+(0.0825)(14)]\implies A=1600(2.155)\implies A=3448[/tex]

Determine the probability of the treatment group’s mean being greater than the control group’s mean by 8 points or more. Then complete the statements.

The significance level is set at 5%, and the probability of the result is
%, which is
the significance level. The result is
.

Answers

The probability of the treatment group’s mean being greater than the control group’s mean by 8 points or more is 0.036.

How to calculate the probability?

The probability of the treatment group’s mean being greater than the control group’s mean by 8 points or more will be:

= (26 + 8 + 2)/1000

= 36/1000

= 0.036

The significance level is set at 5%, and the probability of the result is statistically significant because the probability of the difference is less than 5% significance level.

Learn more about probability on:

brainly.com/question/24756209

#SPJ1

Type the correct answer in the box.
The value of is .

Answers

The answer is 1 because you need to transform the expression then simplify it
The answer is 1, hope this helps
Other Questions
In dry climates, ________ is a common mechanical weathering process. A) exfoliation B) frost wedging C) salt wedging D) carbonation Read these lines from Fredrick Douglass's speech "What to The Slave Is the Fourth of July?"The blessings in which you this day rejoice, are not enjoyed in common.Which of the following correctly defines the word common as it is used here?Of ordinary occurrence; usualOf the most familiar typeO Falling below ordinary standardsShared alike by all the persons in question HELP ME CJDUCIF PLEASE I WILL MARK BRAINLIST You and your family are going on afamily cruise this summer! WOO HOO!Your parents had to put down a $250deposit. Then, the cruise costs $500per person on top of that. There are 5people in your family. How much willthe entire cruise cost? Okay our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? our cell phone costs $50 a month plus $0.25 for each text message, t. How much would your monthly bill be if you sent 40 text messages? Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface?