Why does every assignment have to be so confusing

Answers

Answer 1

Answer:

some teachers dont understand

Explanation:


Related Questions

Whom is Twain ridiculing? Check the two boxes that apply.

Answers

Answer:

twain mark was a kind duke

Answer:

The judge and the Townspeople

Which factor contributed to the rise of the Babylonian Empire? The Babylonians returned to local rule. The Babylonians conquered the Akkadians. The Babylonians destroyed the Hittite capital. The Babylonians took over the Fertile Crescent.

Answers

Answer:

I'm pretty sure its d, The Babylonians took over the Fertile Crescent.

Explanation:

Answer: It is D 100%

Explanation:

I took the test. ( pls crown)

What factors led to the Industrial Revolution beginning in Great Britain?

Answers

Answer:

Raw materials, new inventions, trade routes, partners, social changes,and a stable These were all a factor because people fought and argued over these things.

Why was a written language so important to early governments?

Answers

Answer:

Written language was important so early governments because they would write historical documents.

Explanation:

Where did the killings of the genocide begin? (capital city of Rwanda)

Answers

Answer: Genocide as a historical term is as old as civilization.

Explanation:

Throughout the history of humankind, we find many traces of crimes that allude to genocidal acts. However, genocide as a legal form emerged after the Second World War and the genocide of Jews. Its definition was given by the Polish lawyer Raphael Lemkin. Yet genocide as a historical form is much older than the Holocaust of World War II. When we talk about the genocide in Rwanda, it happened during 1994. The capital of Rwanda (Kigali) was the site of one of the most horrific genocides in history.

However, crimes took place across the country. In less than a year, the multi-ethnic Hutu tribe killed about a million members of the Tutsi minority. They eliminated as many as 10,000 people a day. The root of this horrible genocidal action has its historical traces. Namely, Rwanda was a Belgian colony for a long time, a tribe of Tutsi, and if few, it was dominant for a long time. The reason lies in the fact that they are more educated. The Houthis shot down the presidential plane and blamed the Tutsis for it. That is how the genocide began. The United Nations and the world have done almost nothing to prevent the horrific crimes that have taken place across the country.

Answer:

kigali

Explanation:

Factors that Pulled African Americans to the North
2 reasons​

Answers

Answer: Racism and economic troubles.

Explanation:

These are the elementary reasons for the migration of African Americans to the north. Segregation was very pronounced in the South. A huge number of African Americans have experienced some discrimination in the South. A large number of that population were lynched, so living conditions were impossible. In such circumstances, economic reasons were the cause-effect relationship. A society that discriminates against the population because of skin color did not provide even the minimum economic conditions.

Both pieces of writing attacked the practices of the
Catholic Church. Yet one led to a complete break, while the other did not. What in
Luther’s words seems uncompromising, and what in Erasmus’ words leaves more
room for reform?

Answers

Answer:

I do not understand this question please put more details

Explanation:

I would appreciate it.

WILL GIVE BRAINLIEST!!!!
What happened when the demand for scones rose?

Answers

Answer:

If the demand is very high

AND

supply matches the demand OR the supply doesn't match the demand, the higher demand leads to a higher equilibrium price.

Explanation.

It depends on the law of supply and demand. If the supply matches the demand OR the supply doesn't match the demand, the higher demand leads to a higher equilibrium price. But when the demand is less but supply is excess, the prices drop.

Answer:

maybe people were hungry and needed food because the prices went up and couldn't afford them

What percentage of Jobs created by travel and tourism are directly related to the industry?
91 percent
21 percent
51 percent
71 percent

Answers

It might be 51 percent or 21 percent
you answer is 71% !!

2_The English Bill of Rights abolished excessive fines and cruel or unjust punishment and affirmed the principle of habeas
corpus (no person can be held in prison without first being charged with a specific crime). Would it be true or false?

Answers

Answer: I believe this is true.

Explanation: the reason I say this is because in the 8th amendment sates “Excessive bail shall not be required, nor excessive fines imposed, nor cruel and unusual punishments inflicted.”.

The doctrine of ______, in which a state declared that a federal law was not in effect within the state's border, was a long- established theme of protest against percevied excesses by the federal government

Answers

Answer:

nullification

Explanation:

The Doctrine of Nullification which was believed to have been favored by the likes of Thomas Jefferson is a legal theory that implied that any state that is part of the Union possesses the unilateral and natural liberty to invalidate or repeal any law established by the federal government that could be considered unconstitutional.

The doctrine of nullification was exercised during the period known as the nullification crisis by the South Carolina legislature. Where it voided the Tariffs of 1828 and 1832

Why did Britain issue the Proclamation of 1763?

A. To tax the colonists
B. To repeal the Coercive Acts
C. To punish colonists for the Boston Tea Party
D. To prevent colonists from moving west​

Answers

I am pretty certain it is d

WILL MARK BRAINLIEST FR! TO THE CORRECT ANSWER! 50 POINTS MY FRIENDS!!!! I WILL REPORT IF THE ANSWER ISN'T A REAL ANSWER THO AND I DON'T WANNA HAVE TO DO THAT SO PLEASE ANSWER CORRECTLY THANK YOOOOOU!!!!
Why was the election of 1800 a turning point in American history?

A. It gave the Federalists more power.
B. It was the first time that political power shifted.
C. Jefferson beat Burr by a huge number of electoral votes.
D. Adams ran against Jefferson for the second time.

Answers

Answer:

B

Explanation:

I took the test and got it right

Answer:

B. it was the first time that political power shifted

Explanation:

have a nice day :)

Why did the World Feel the Need to honor Veterans After
WWI and not after the Thirty Years War?

Answers

It was a WORLD WAR, they were fighting for the world

please help me :( anything will help​

Answers

Answer:

i think the answer is B. separatist

Explanation:

a separatist is a person who supports the separation of a particular group of people from a larger body on the basis of ethnicity, religion, or gender.

hope this helps and feel free to give brainiest

Which of the following difficulties would nations that are enclaves most likely face?
A.
They are often geographically distant from their governing nations, making administration difficult.
B.
Their border is controlled by another nation that could cut off access to trade in times of conflict.
C.
They depend on another country for military protection and economic assistance.
D.
Other independent states do not recognize their independence, even though they are self-governing.

Answers

Answer:

B.

Explanation:

An enclave is a territory surrounded by territory of other state. It is an outlying part of a country that is mostly or partly surrounded by another state's territory.

The difficulties faced by an enclaves is that the border is controlled by another state, which may hinder the enclaved territory during conflict times. During such times, borders of other states may cut off access to trade.

Therefore, option B is correct.

Answer:

B

Explanation:

In your opinion, what was the biggest source of conflict between the United States and tribes living on the Great Plains before and during the Plains Wars? What eventually brought an end to the Plains Wars? Explain your answer in 75 to 100 words.

Answers

Answer:

Vast land

Explanation:

The great plains were the region of Texas, Kansas, Colorado, Nebraska, and Oklahoma. In the 1840s, settlers moved west to the Great Plains as they were looking for gold and land.

Settlers were not the only inhabitant in the Great Plains but also had many Indians tribes. The government tried to get their land and sell it to settlers. Many of the Indians were hunters, not farmers. They relied on nature for their survival. Buffalo lived on the Great Plains, and Indians hunted them for food and other uses.

The destruction of Buffalo herds was the trainloads which allowed white men who shoot bison in the Plains. Bison killed as the government gave the authorization to shoot to clear land for farming and to make Native Indians declined. Native Indians depended on the bison for their fur, skin, meat, and fur.

The Sand Creek Massacre, the Battle of wounded Knee, and Battle of the Little Bighorn were some of the famous battles. The defeat of the Indians brought an end of the conflict with sending them to live in the reservations.

Answer:

The movement of white settlers to the West was a big source of conflict between the United States and the tribes of the Great Plains. The government moved the tribes onto the reservations to make room for US settlement. The tribes’ way of life, including hunting bison across the Great Plains, conflicted with expanding settlement.

In the end, the Native Americans on the Great Plains could no longer find enough food to survive. The bison they hunted disappeared as more people hunted the animals for sport. Though the tribes tried to fight back, US troops didn’t give up their campaign to move Native Americans onto reservations in Indian Territory.

Explanation:PLATO

Read the passage from Garrison's message “To the Public” from The Liberator.

Which of these statements best describes how Garrison feels about slavery?

It is a problem that should be solved immediately.

It is a problem best solved gradually.

It is a problem with no solution.

It is not a problem for America.

GUYS ITS A. It is a problem that should be solved immediately
ILY <3

Answers

Answer:A

Explanation:

Answer: A

Explanation:

Bc

⦁ "The people of the village began to gather in the square, between the post office and the bank, around ten o'clock; in some towns there were so many people that the lottery took two days and had to be started on June 25th. But in this village, where there were only about three hundred people, the whole lottery took less than two hours, so it could begin at ten o'clock in the morning and still be through in time to allow the villagers to get home for noon dinner." 5. Which Point of View is used for A

Answers

The author point of view

Which political change did Lenin impose after the Civil War?

a) He encouraged nationalism to build up faith in the Russian government

b) He moved the capital from Moscow to Leningrad.

c) He createe a democratic government where the people held all the power.

d) He organized Russia into smaller republics that governed the territories ​

Answers

c) a democratic government

Read the following passage and answer the question. It makes me sad to know that there are many cats living outside during the cold New England winters. That is why I support my local animal shelter, Kitty Angels, by donating food and supplies to their cause. Which point of view is being used in this passage? third-person point of view second-person point of view both first- and third-person points of view are being used first-person point of view. piz help???

Answers

Answer:

first person

Explanation:

i uses I, if a sentence uses I, me, my, ect. it is FIRST person!!

Answer:

First person

Explanation:

We, us, our, and ourselves are all first-person pronouns. Specifically, they are plural first-person pronouns. Singular first-person pronouns include I, me, my, mine and myself.  

Hope this helps ;)

WILL GIVE BRAINLIEST!!!

1. What were the Four MAIN Causes of World War I?
2. Choose 2 of those Causes you listed and explain how that was a contributed to the start of World War l.

Answers

Answer:

The major causes of “The Great War” or WWI (1914-1918) consist of four long-term causes and one short-term cause. I use the acronym M.A.N.I.A to help my students remember the 5 major causes of WWI; they are Militarism, Alliances, Nationalism, Imperialism, and Assassination

Answer:

Militarism, alliances, imperialism, and nationalism

1.   Imperialism:   Desire for Self-Sufficiency

2.  Nationalism :  A person's love for their country. Fueled by European countries wanting to colonize non-industrialized countries. Nationalism is a feeling of pride in their country. Language, history, and culture.

Explanation:

what does a law start out as?​

Answers

Answer:

A bill

Explanation:

Timed Test! Please help
Select all that apply.

Three possible reasons for the expansion of smaller kingdoms are _____.

The grass is greener elsewhere.
A larger population requires more food.
Leaders are greedy for more power and land.
Neighbors are becoming too strong.
It is better to be larger than smaller.

Answers

Answer:

1. Its better to be larger.

2. Leaders are greedy.

3. Neighbors are becoming too strong.

Coup d’etats are most often extremely peaceful. very violent. unsuccessful. long lasting.

Answers

Answer:

Very violent.

Explanation:

These are mainly used to overthrow the government & rebel.

Got it right on Edge.

Coup d’etats are most often extremely very violent. Hence, the correct answer is option B. very violent. Read below about coup d' etats.

What is Coup d’etats?

A coup d'état, also known as a coup or overthrow, is a seizure and removal of a government and its powers. Typically, it is an illegal seizure of power by a political faction, rebel group, military, or a dictator. Coups have been a feature of regime change for most of recorded history.

Therefore, the correct answer is option B. very violent.

learn more about coup d' etats: https://brainly.com/question/1220989

#SPJ9

markings brainliesttt!!!!!

Answers

Answer:

to promote understanding.....

Explanation:

i just did it

To promote understanding! My explanation: I did this test :)

Which statement about the Articles of Confederation is true? They officially announced the independence of the United States and started the Revolutionary War.(a) They were the first constitution of the United States, and they united the newly independent states under a national government with limited power.B) They established the United States as a protectorate of Great Britain, capable of creating its own laws but relying on the British armed forces to defend it.C)

Answers

Answer:

(a) They were the first constitution of the United States, and they united the newly independent states under a national government with limited power.

Explanation:

The Articles of Confederation was completely ratified in 1781 with every state agreeing to the ratification, which was the first Constitution of the United States following the American War of Independence.

However, this constitution lacks a central government or power over foreign and domestic commerce, which implies that the national government has limited power.

Hence, in this case, the correct answer is option A. They were the first constitution of the United States, and they united the newly independent states under a national government with limited power.

Answer:

the answer is a

Explanation:i just did this test :>

Federal district courts do not try military cases, claims brought against the U.S. government, or tax disputes between citizens and the
government because
O A. they cannot be expected to rule impartially on cases involving the government
B.
original jurisdiction for such cases belongs
the Supreme Court
O C.
such cases are tried only in state courts
OD
Congress has created specialized courts to deal with such cases

Answers

The answer is c
Can you mark me brainless

Answer:

c

Explanation:

cause i got it right i had course recovery

what is the last safe place for loyalists by march 15,1783

Answers

Answer:

Explanation:

Libya's interim leadership gave Moammar Gadhafi loyalists one more week to surrender before they face military force in the last bastions of the strongman's power.

Read the writing prompt.

Write an informative research-based essay comparing the political structure of ancient Greek city-states to the political structure of the Roman Empire.

When preparing to respond to this prompt, which research question would be the most effective?

Who was the best Roman emperor?
How was the Roman Empire organized?
Who did the ancient Greek city-states trade with?
Why did Athens and Sparta fight the Peloponnesian War?

Answers

Answer:

the 3rd option is the best choice

Answer:

Is B;)

Explanation:

Other Questions
why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns