Why is the earth considered a magnet? What is a permanent magnet? describes an electromagnet

Answers

Answer 1

Answer: *See Explanation*

Explanation: The earth's core "generates" its own magnetic field....so it is considered a magnet. A good example of a "Permanent Magnet" would be the Earth's crust. Not the crust itself, but the effect it causes. A "Electromagnet" is made by passing electric currents through a coil surrounding it. (I know, it's a bit confusing.) Check other sources if it is too confusing.


Related Questions

Which pathogen is most likely responsible for causing hoof-and-mouth disease on livestock?

Answers

Answer:

D

Explanation:

A virus, because it requires a host cell to reproduce

Has anyone done aqa a level biological molecules exampro exam paper

Answers

Answer:

No sorry

Explanation:

In seedless plants, haploid gametophytes are produced from
A; diploid spores that undergo mitosis.
B: haploid spores that undergo meiosis.
C; diploid spores that undergo meiosis.
D; haploid spores that undergo mitosis.

Answers

Answer: It's A!!

Explanation:

Answer:

diploid spores

In seedless plants, haploid gametophytes are produced from a diploid spores that undergo mitosis.

Explanation:

The cell structure at the arrow in the picture below is present in these cells which line the airways, but are NOT present in bacteria. What is the cell structure at the arrow?

Answers

Answer:

The cell membrane

Explanation:

The arrow is pointing to the outside ¨shell¨ so to speak which is the cell membrane, bacteria do not have cell membranes

Examples of ovoviviparous animal

Answers

Answer:

sharks, rays, snakes, fishes, and insects

Explanation:

These ovoviviparous animals produce eggs, but instead of laying eggs, eggs develop inside the mother's body. The eggs are laid in the mother. After rocking, they stay in the mother for a while and feed there. Then the young are born live.

Ovoviparity is, therefore, a mixture of oviparous (animals that lay eggs) and viviparous (animals that develop in the mother’s body).

The image of a slide of onion epithelial tissue observed with the low-power objective of a
compound microscope appears light and somewhat fuzzy. Which parts of the microscope should be used to improve the focus?
coarse adjustment and ocular
fine adjustment and diaphragm
ocular and nosepiece
diaphragm and 40x objective
Od

Answers

Answer:

Fine adjustment and diaphragm

Explanation:

If I were to make hot cocoa which consists of chocolate syrup and milk, identify the solution
a. chocolate syrup
b. milk
c. none of the above
d. hot cocoa

Answers

D. Hot cocoa is the solution=answer
i believe the answer is d

RED HAIR IN HUMANS……
PLEASE HELP ILL PUT U IN BRAINLIEST

Answers

Answer: A B E

Explanation:

It’s A B and E hope this helped!

ocean trenches are most often formed when

Answers

Ocean trenches are deep sections of the ocean where an oceanic plate is usually sinking below a continental plate. How are they formed? They are formed in the subduction zone as the denser oceanic plate is subjected under the continental plate.

Answer:Ocean trenches are driven by tectonics and are most commonly found along the Pacific Ocean in a zone known as the ring of fire. They are usually formed at the boundaries of convergent plates, at a region where a continental plate submerges beneath an oceanic plate.

Explanation:

What is the correct answer?

Answers

Answer:

The correct answer is A

It is “A” that’s the correct answer I believe

a, b, c, or d. first answer gets brainliest

Answers

Answer: B

Explanation: You can eliminate A and C right off the bat bc there not pushing towards each other and it’s not D bc this is the ground not high off of the ground like a mountain so therefore the answer is B

30 points, please answer question in picture :) i need help

Answers

Answer:

the answer is A

Explanation:

because 6 is where it reaches the highest point

PLEASE HELP!!!? Are humans an invasive species? Why or why not. GIVE TWO PIECES OF EVIDENCE TO SUPPORT YOUR OPINION.

Answers

Answer:

I think yes, humans are an invasive species.

Explantation:

        I think humans are an invasive species because they are everywhere, and very few places in the world do not have humans. Humans are in control of the planet because of their number. Humans are not going to be extinct ever. They are always going to be here on earth. If somebody finds new land, they make a base/camp and send other people to live there and to populate it. Like in North america, settlers came and sent men to live there. They hunted animals and set up homes. Then, more and more people came and soon all that is left is a over populated land with citys and cars and humans everywhere.

I hope this helps. :)

When we sleep, what happens to our body temperature?

a
It stays the same
b
It increases
c
It decreases
d
Nothing

Answers

Answer:

C, it decreases. It's natural for your body temperature to decrease during REM period of sleep.

cholesterol is synthesized by all animal cells and is an essential structural component of animal cell's membrane cholesterol is the most common steroid and mainly synthesized in the liver cholesterol also serves as a processor for several important biological compounds including all except insulin ,vitamin D, bile salts , testosterone.​

Answers

Answer:

Aug 11, 2017 — Vitamin D3 is produced in the skin from 7-dehydrocholesterol by UV irradiation, 1,25(OH)2D reduces 1,25(OH)2D levels in cells primarily by  Animals null for calbindin 9k (the major calbindin in mammalian abnormal vitamin D and/or calcium metabolism in some but not all of these patients (24-26). Cholesterol, a waxy substance that is present in blood plasma and in all animal tissues.  it is a primary component of the membrane that surrounds each cell, and it is  synthesizes bile acids, steroid hormones, and vitamin D. Cholesterol  are essential energy sources and structural components of all life

PLZZZZ HEELLLPPPP need sooon

Answers

Answer:

1.ecological

2.ecological?

3. genetic

4.

5.

6.ecological

7. genetic

8. species

9. ecological

Explanation:

here are some sorry i was trying to go fast

Which 3 characteristics did Darwin observe that were slightly different in a population?
A function, breeding habits, food sources
B form, function, behavior
C behavior, form, food sources
D form, breeding habits, behavior

Answers

Answer:

B. form, function, behavior

Explanation:

mountain trekkers use alcohol thermometer, why?

Answers

Answer:They are used rather than mercury thermomethers to in very cold religions because alcohol has lower

Answer:

They are used rather than mercury thermomethers to in very cold religions because alcohol has lower

Explanation:

What is the name for a substance that keeps
the pH in cells within the 6.5 to 7.5 pH range?

Answers

Answer: Neutral

Explanation:

“6.5 to 7.5—neutral. over 7.5—alkaline. less than 6.5—acidic, pH less than 5.5 are considered strongly acidic.“

Which statement best describes what happens during translation?

Answers

Answer:

B

Explanation:

The entire process is called gene expression. In translation, messenger RNA (mRNA) is decoded in a ribosome, outside the nucleus, to produce a specific amino acid chain, or polypeptide. The polypeptide later folds into an active protein and performs its functions in the cell.

During translation, the ribosome reads the mRNA and uses the information to assemble a protein.

Translation is the second step of protein synthesis. It takes place in the ribosome, a complex structure made up of proteins and RNA. The ribosome reads the mRNA, a molecule that contains the genetic information for a protein. The mRNA is translated into a protein by a process called codon-anticodon pairing.

Codons are three-base sequences in mRNA that code for specific amino acids. Anticodons are complementary sequences in tRNA molecules that bind to specific codons. When the ribosome encounters a codon in the mRNA, it brings in the corresponding tRNA molecule. The tRNA molecule carries the amino acid that corresponds to the codon.

The amino acid is then added to the growing polypeptide chain. The ribosome continues to move down the mRNA, reading codons and adding amino acids until the entire protein is synthesized.

To learn more about translation, here

https://brainly.com/question/29979094

#SPJ2

What are the major parts of one molecule of ATP? (3 parts)

Answers

Answer:

Adenine ,ribose, covalent bonds

Explanation:

Search Results

Featured snippet from the web

An ATP molecule consists of three parts. One part is a double ring of carbon and nitrogen atoms called adenine. Attached to the adenine molecule is a small five-carbon carbohydrate called ribose. Attached to the ribose molecule are three phosphate units linked together by covalent bonds.

What are the two endocrine organs that work together to control blood calcium levels?

Answers

Answer:

:)))))

Explanation:

:::::::::::::::::::::::))))))))))))))))))

An animal cell: the human body. Different but also alike. Your brain is the control center of your body. What is the control center of the animal cell?

Answers

Answer:

the nucleus is the center of the animal cell

Pls hurry and answer I’ll give brainliest

Answers

Answer:

D

Explanation:

might be wrong

C.

Explanation: the animal cells do not have a Cell wall, only a membrane. The vacuoles store food for later.

Analyze: Click the FOREST tab. Click the plus (+) button for mushrooms several times. Click Advance year a few times. Select the DATA tab. How did adding mushrooms affect trees? GIZMOS.

Answers

Answer

82

Explanation:

i think

Answer:5b

Explanation:itchy

Chromosomes that have the same structure, size and carry the same genes but different versions of that gene.
A. Identical Chromatids
B. Homologous Chromosomes
C. Centromeres
D. Heterozygous Chromosomes

Answers

Answer:

heterozygous chromosomes

Explanation:

They're both the same size and the same gene, but their different versions

The red line in this diagram represents: *

Answers

red line shows the conditions under which a solid can be converted directly to a gas (and vice-versa)

please help me, i dont like this

Answers

Answer:

yes this is true

Explanation:

have a nice day!

the answer is true !

What are three methods for detecting radioactively labeled DNA in an experiment?

Answers

Answer:

Limitations. detect low abundance DNA binding proteins from lysates. test binding site mutations using many probe configurations with the same lysate. test binding affinity through DNA probe mutational analysis. non-radioactive EMSA possible using biotinylated or fluorescently labeled DNA probes.

Explanation:

Answer:

Proteins interact with DNA through electrostatic interactions (salt bridges), dipolar interactions (hydrogen bonding, H-bonds), entropic effects (hydrophobic interactions) and dispersion forces (base stacking). These forces contribute in varying degrees to proteins binding in a sequence-specific or non–sequence-specific manner.

Explanation:

Which best describes the process of insertion?

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

B.occurs when part of a chromosome breaks off and reattaches backward on the same chromosome

C.occurs when part of a chromosome breaks off and does not reattach

D.occurs when part of a chromosome breaks off and attaches to another chromosome

Answers

Answer:

A.occurs when part of a chromosome breaks off and is placed into the middle of another chromosome

Explanation:

Edge 2020

Answer:

A

Explanation:

EDGE2021 :-)

Have a nice day! ^-^

Other Questions
what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.) What is the mass of HF produced by three reaction of 3.0 10 to the 23 molecules of H2 with excess F2 Please help this one is also due tomorrow Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas? Choose the word or phrase that best completes each sentence. prepared the body for its journey to the afterlife.The were constructed as tombs for the pharaohs and their relatives.Tutankhamen's tomb was an important archaeological find because it was the only ever found. Ratios. May someone help me, also may you please add the explanation. question one : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) colliding with each otherquestion two : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) moving towards, then moving away from each otherquestion three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?a) the rocks are youngest the further away you move from the ridgeb) the rocks are oldest the further away you move from the ridgec) the rocks are the same age no matter how far away from the ridge you moved) the rocks do not age