Why would allowing a plant to undergo photosynthesis 24 hours a day cause it to grow faster?

Answers

Answer 1
Photosynthesis involves two biochemical processes, known as light reaction and dark reaction. During light reaction, the plant absorbs light and turns it into energy. ... Because dark reactions do not require the absence of light, plants will remain healthy when exposed to light 24 hours a day.

Related Questions

Can someone plz help me out. I don’t really understand this.

Answers

7. b and 8. c i attached the photo for u to see how i did it

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

Describe why food needs to be digested from large to small molecules.

Answers

Answer:

Food must be broken down into nutrients for the body to use for energy, development, and cell repair. Before the blood absorbs and transports nutrients to cells in the body, food and drink must be broken down into smaller nutrient molecules.

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

what is membrane potential of a cardiac intrinsic conduction system cell?

Answers

A gradient of electrochemical potential exists across cellular membranes, allowing cardiac cells to exclusively propagate action potentials. An average cardiac cell's resting membrane potential is 90 mV.

The Goldman-Hodgkin-Katz equation, which considers permeability (P) as well as the concentration of ions both within and outside of cells ([X]), can be used to characterise this resting potential. The network of intracardiac ganglia and connecting neurons makes up the intrinsic cardiac neural system (ICNS), sometimes known as the heart's own nervous system. As a local hub that combines the inputs from the ICNS and extrinsic innervation, the cardiac ganglia function as a contributor to the tight control of cardiac electrophysiology.

To know more about electrochemical, click here:

https://brainly.com/question/31606417

#SPJ4

What percent of energy is transferred between the levels indicated by the blue arrows?

A. 50

B. 90

C. 100

D. 10

Answers

The answer to the given question is that more than 100 percent of energy is transferred between the levels indicated by the blue arrows.

This is because the blue arrows show the flow of energy between trophic levels in an ecosystem and there is always a loss of energy in each transfer due to metabolic processes like respiration and incomplete digestion.The transfer of energy between trophic levels of an ecosystem is known as the energy pyramid. In general, only 10% of the energy at one level is available to the next level. For example, if the primary producers contain 10,000 units of energy, then only 1,000 units of energy will be transferred to the primary consumers.

However, some energy can be lost due to factors such as heat loss from the body of organisms, incomplete digestion, and inefficiencies in energy transfer mechanisms. Therefore, it is possible for more than 100% of energy to be transferred between the levels indicated by the blue arrows. Therefore, the correct answer is not given in the option, it is more than 100 percent.

To know more about percent visit:

https://brainly.com/question/14809038

#SPJ11

Which of the following would be considered adaptations for a predator? Select ALL that apply.
A. Thorns on a plant
B. Sharp Claws
C. Aposematism (Warning Coloration)
D. Strong sense of smell
E. Ability to run quickly

Answers

The adaptations of a predator from the given options would be sharp claws, aposematism (warning coloration), a strong sense of smell, and the ability to run quickly. Here options B, C, D, and E are the correct answer.

B. Sharp Claws: Sharp claws enable a predator to grasp and immobilize prey, providing an advantage in capturing and subduing prey efficiently.

C. Aposematism (Warning Coloration): Aposematism refers to the display of vibrant, contrasting colors or patterns that warn potential prey of the predator's toxicity or dangerous nature. This adaptation deters potential prey from approaching or attacking the predator, allowing it to avoid unnecessary conflict and conserve energy.

D. Strong sense of smell: A predator with a keen sense of smell can detect the scent trails left by prey, increasing its ability to locate and track potential targets. This adaptation provides an advantage in locating prey and improving hunting success.

E. Ability to run quickly: The ability to run swiftly is advantageous for predators as it enables them to chase down prey, close the distance, and launch an attack. This adaptation improves their chances of capturing fleeing prey.

To learn more about predators

https://brainly.com/question/28871161

#SPJ4

Describe: How does a virus destroy the host cell’s DNA?

Answers

Answer:

it eats away at the host from the inside

Explanation:

wykonaj tabele w której porównasz funkcje wszystkich rodzajów elementów morfotycznych krwi

Answers

Is this a question or just a prank?

Match the following world's countries with the plate boundary they are located Ethiopia, Kenya, Tanzania region Continent-Continent Div [选择] Ocean-Ocean Convegent Japan ✓ Ocean-Continent Convergent Continent-Continent Transform Ocean-Ocean Divergent Continent-Continent Divergent Iceland Continent-Continent Convergent Ecuador/Western South America Continent-Continent Co USA/Southern California Ocean-Continent Conve v Nepal/Tibet/China region Continent-Continent Co

Answers

Here is the matching of the countries with the corresponding plate boundary:

Ethiopia, Kenya, Tanzania region: Continent-Continent Divergent

Japan: Ocean-Ocean Convergent

Iceland: Continent-Continent Divergent

Ecuador/Western South America: Continent-Continent Convergent

USA/Southern California: Ocean-Continent Convergent

Nepal/Tibet/China region: Continent-Continent Convergent

Let's explain the reasoning behind each match:

Ethiopia, Kenya, Tanzania region:

This region is located along the East African Rift System, which is a classic example of a continent-continent divergent boundary.

It is where the African Plate and the Somali Plate are moving away from each other, causing the formation of a rift valley.

Japan: Japan is situated along the Pacific Ring of Fire, which is characterized by subduction zones where oceanic plates converge with continental plates.

Therefore, Japan is located at an ocean-ocean convergent boundary.

Iceland: Iceland is located on the Mid-Atlantic Ridge, which is a divergent boundary between the Eurasian Plate and the North American Plate.

As the plates move apart, magma rises to the surface, creating new crust and causing volcanic activity.

Thus, Iceland is at a continent-continent divergent boundary.

Ecuador/Western South America:

This region lies along the boundary between the Nazca Plate and the South American Plate.

The Nazca Plate is subducting beneath the South American Plate, resulting in the formation of the Andes Mountains.

Hence, Ecuador and Western South America are located at a continent-continent convergent boundary.

USA/Southern California: Southern California is located along the boundary between the Pacific Plate and the North American Plate.

The Pacific Plate is moving northwestward relative to the North American Plate, resulting in a transform boundary.

Therefore, the plate boundary in this region is a continent-continent transform boundary.

Nepal/Tibet/China region:

This region is part of the Himalayan mountain range, formed by the collision of the Indian Plate with the Eurasian Plate.

It is a classic example of a continent-continent convergent boundary.

It's important to note that plate boundaries can be complex and may have variations within a particular region.

The matches provided here represent simplified classifications for each country's general plate boundary.

For similar question on Eurasian Plate.

https://brainly.com/question/16939139

#SPJ8

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

in addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by choose one: a. serving as a channel for export of the cholera toxin. b. releasing antimicrobial agents to kill members of the normal microbiota. c. transmitting signals to communicate with other v. cholerae. d. binding to the promoters of genes involved in virulence. e. injecting effectors directly into the cells of the intestinal epithelium.

Answers

In addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by c. transmitting signals to communicate with other v. cholerae

Membrane proteins not only provide structural support and mediate transport but are also important for allowing bacteria to sense and respond to changes in their environment. The toxR protein is found in the plasma membrane of Vibrio cholerae cells. It responds to pH and temperatures characteristic of the human gut environment by transmitting signals to communicate with other V. cholerae. The ToxR protein is a transmembrane protein that is vital for the pathogenesis of Vibrio cholerae, the causative agent of cholera.

It functions as a transcription factor and regulates the expression of many virulence genes. ToxR, ToxS, and TcpP are three regulatory proteins that are essential for the transcription of virulence genes in Vibrio cholerae. They function as a complex to activate or repress transcription of genes that are important for the virulence of this bacterium. Therefore, option C, transmitting signals to communicate with other V. cholerae is the correct answer.

Learn more about transcription at

https://brainly.com/question/13673064

#SPJ11

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

Which claim about reproduction in dogs can best be supported using a valid argument?
A. Offspring produced by sexual reproduction are genetically identical.
B. Gametes from both dogs are needed to maintain the correct number of chromosomes in the offspring
C. Phenotypic variation will occur in the offspring as a result of mitosis in the gametes.
D. Binary fission is required for sexual and asexual reproduction in dogs.

Answers

Answer:

b

Explanation:

This plant is used to treat liver ailments during the medieval times
Liverworts
Hornworts
Mosses
Ferns

Answers

Answer:

liverworts

Explanation:

Answer:

liverworts

Explanation:

that's were it got its name because of it healing properties

A simple guideline to follow for deloading is to train at less than intensity and less than volume of what is used during a standard training session. A. 40%, 40% B. 50%, 50% C. 70%, 70% D. 80%, 80%

Answers

The guideline recommends using 50% of the intensity and 50% of the volume of what is typically used during a standard training session. Therefore, option B is correct.

When deloading, it is recommended to train at a lower intensity and lower volume compared to a standard training session. The recommendation is to employ 50% of the volume and 50% of the intensity that is generally used during a typical training session.

This technique enables to provide a period of reduced stress on the body. It allows for recovery and adaptation to occur.

Learn more about intensity, here:

https://brainly.com/question/17583145

#SPJ4

What is the function of stabilizing proteins?​

Answers

Answer:

Stabilization of a protein translates into preservation of the protein structure during storage, in thermodynamic equilibrium with its surrounding

Explanation:

mark me brainlest

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

Which kingdoms contain organisms that have cell walls?

Answers

The plantae,Protista, eubacteria kingdom. I think it’s just the 3.

The function of cell wall is to provide protection. The kingdoms which have cell walls are  fungi and plantae.

What is the function of cell wall ?

The cell wall provides the protection against the  mechanical stress and the pressure that a cell membrane can not handle.

Cell wall is majorly present for the purpose of protection to the species and these species tend to be delicate and tend to be in more danger.

Cell wall of fungi is made up of chitin and it is polysaccharide having the amino glycosidic linkages.

Cell wall of plants is made up of polysaccharides as well where the cellulose is present in chains.

Cellulose provides the tensile strength and this amino  glycosidic linkages tend to provide strong skeletal structures in order to provide protection to the specimen.

Therefore only plantae and fungi have the cell walls.

https://brainly.com/question/965751

#SPJ6

Which kingdom contains the first eukaryotes?

Answers

Fungi hope this helps

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. What type of evidence would provide the best support for this claim?
A.evidence showing birds shared similar habitats with dinosaurs
B.evidence showing birds shared similar nutritional requirements as dinosaurs
C.evidence showing birds shared similar behaviors with dinosaurs
D. evidence showing birds shared a common genetic history with dinosaurs

Answers

Answer: D.

Explanation: I don’t really know how to explain it, I just know it’s right

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. The liable options seems evidence showing birds shared a common genetic history with dinosaurs. The correct answer is option D.

What is the class of birds ?

It is the class aves that belong to the kingdom Animalia.

The birds and the dinosaurs have the same genetic history that is the phylogenetic relationship of both the species is almost same and they both show a similar set of characteristics.

They had multiple set of characteristics that were similar to both and they shared the common characteristics. The points are written as following :

1.Egg Laying

2.Scales

3.Feathers

4.Beaks

5.Diets

6.Reptilian Relations

7.Three-Toed Limbs

8.Claws.

These were the common characters that were present in both the categories.

Learn more about birds at :

https://brainly.com/question/25120645

#SPJ2

Which of the following describes a mechanism by which microtubules are known to be statſilized? a) Shortening of the GTP cap. b) Increasing the proportion of alpha-tubulin subunits relative to beta-tubulin subunits. c) Binding of microtubule binding proteins, such as Tau. d) Conformational changes undertaken by beta-tubulin as it bhydrolyzes GTP.

Answers

Microtubule stabilisation is known to occur through the interaction of microtubule-binding proteins like Tau. Hence (c) is the correct opton.

Cell division, ciliogenesis, and intracellular trafficking are three crucial eukaryotic processes that are mediated by microtubules, which are cytoskeletal elements. They come together from -tubulin heterodimers and separate through a process known as dynamic instability that is triggered by GTP hydrolysis. They have a role in a number of cell motions, including as some types of cell motility, the intracellular movement of organelles, and the division of the chromosomes during mitosis, in addition to determining the shape of the cell. These findings imply that GTP functions in microtubule assembly by first giving tubulin a conformation that is conducive to polymerization, and then by hydrolyzing GTP bound to tubulin to irreversibly change the balance in favour of polymerization.

To know more about Microtubule, click here:

https://brainly.com/question/31670866

#SPJ4

what does it mean to be purebread ?

Answers

Answer:

If you meant purebred, it means that the species had not been bred with any other species than it`s own.

Ex: a purebred dog bred with another purebred dog produced a purebred offspring

a purebred dog bred with either another species of dog, or a crossbred dog will produce a crossbred offspring

Explanation:

the step of translation in which release factors bind to a stop codon is

Answers

The step of translation in which release factors bind to a stop codon is termination. During this step, the ribosome recognizes the stop codon and triggers the release of the newly synthesized polypeptide chain along with the dissociation of the mRNA and ribosome.

Translation is the process of converting genetic information stored in mRNA into a sequence of amino acids that make up a protein. It is divided into three stages: initiation, elongation, and termination. During termination, the ribosome recognizes the stop codon (UAA, UAG, or UGA) in the mRNA, and a protein called a release factor binds to the A site of the ribosome. This causes the polypeptide chain to be released from the ribosome and folded into its final shape. Finally, the mRNA and the ribosome dissociate from each other. The newly synthesized protein can then undergo further modifications before being transported to its final destination in the cell.

Know more about stop codon, here:

https://brainly.com/question/30104870

#SPJ11

HELP ME

Explain how physical variation is expressed in human beings and how it relates to cultural groups and ethnicity?!??

Answers

Be careful with those links there hackers

In the photo of the house; What is happening to the foundation of
the house?

Answers

Answer:

errosion is causing it to crumble and become unstable

The article named Apes' Simple Nests Are Feats of Engineering. Where the author talks about how apes make their nest and how they use it. Apes make their nest in which they sleep during the night. Roland Ennos of the University of Manchester says that their nests look man -made and it was thought that apes do know how to use wood to make their nests.They also talk about the length and width of the nest. It takes 10 min for an ape to make their nest. From a new study they observe that some apes have a nest similar to bent nests attached between trees and some have oval-shaped nests on the tree branches where they sleep . On the other hand chimps also make similar nests like aps but according to an article it states that chimps sometimes sleep on the ground while aps doesn’t. Chimpanzee nests give a new way to research more on how they make their nest on ground by using some wood, plants and grass to make it comfy rather than on trees that maybe there were less quantities of trees or maybe they have different behavior than others.

Answers

The Apes' Simple Nests Are Feats of Engineering article is about how apes build their nests and how they use them. Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not.

According to the article, it was believed that apes were unable to make nests using wood; however, Roland Ennos of the University of Manchester stated that the nests look man-made. The article also mentions the size of the nest, which is usually large enough for the apes to sleep in at night. It takes only ten minutes for an ape to create its nest. In a recent study, researchers observed that some apes construct nests that resemble bent nests linked between trees, while others construct oval-shaped nests on tree branches where they sleep.
Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not. Chimps' nests provide a new avenue for exploring how they build nests on the ground using wood, plants, and grass to make them more comfortable, which may be due to a lack of trees or different behavior.

To know more about Engineering article visit:

https://brainly.com/question/31525727

#SPJ11

why is correct measurement important​

Answers

Explanation:

help in giving accurate information

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

ECOTOXICOLOGY
6. Discuss the differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology 7. Suggest detailed reasons why dysregulation can lead adverse effects

Answers

Ecotoxicology is a branch of environmental toxicology that investigates the effect of toxicants on organisms in the ecosystem. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

6. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

Dysfunction in ecotoxicology is a type of effect that results from the change in the normal physiological activity of a cell, tissue, or organ. It occurs when the toxicant alters the normal functioning of the target molecule. For example, when a pesticide such as DDT is ingested by an organism, it binds to the sodium ion channels in the nervous system, resulting in the impairment of the nervous system.The destruction of target molecules, on the other hand, is a type of effect that results from the direct alteration of a molecule's structure. It occurs when the toxicant physically alters the chemical structure of the molecule. For example, lead adversely affects organisms by binding to proteins and altering their structure.

7. Reasons why dysregulation can lead to adverse effects

Dysregulation can lead to adverse effects in several ways, including: It affects the normal functioning of the organism and can lead to death.It can result in the accumulation of toxic substances, causing long-term damage to the organism's health.It can lead to the overproduction of certain substances that cause harm to the organism.It can disrupt normal physiological processes, leading to disease and other health problems. Therefore, dysregulation has the potential to lead to serious adverse effects on an organism's health. In conclusion, the understanding of the difference between the destruction and dysfunction of target molecules in ecotoxicology and the knowledge of how dysregulation can lead to adverse effects are crucial for understanding the impact of toxic substances on organisms.

To know more about ecotoxicology visit:

https://brainly.com/question/32533210

#SPJ11

Other Questions
The owners of a chain of fast-food restaurants spend $24 million installing donut makers in all their restaurants. This is expected to increase cash flows by $9 million per year for the next five years. If the discount rate is 5.2%,were the owners correct in making the decision to install donut makers?A. Yes, as it has a net present value (NPV) of $15 million.B.No, as it has a net present value (NPV) of $1 million.C.No, as it has a net present value (NPV) of $3 million.D.Yes, as it has a net present value (NPV) of $9 million. need help ASAP plssssssssssssssssss3,945 45 = (?)R (?) The circumference of a circle is like the ________ of a figure.A. shapeB. perimeterC. area Clinicke Inc. sells merchandise of $800,000 in 2020 that includes a two-year limited warranty against manufacturing defects as part of the selling price. Warranty costs are estimated to be 1% of sales. If the company incurred $2,200 of actual costs in responding to warranty claims in 2020 (related to 2020 sales), how much should Clinicke record in warranty expense for 2020 If f(x) - 2x2 +5./(x-2), complete the following statement:The domain for f(x) is all real numbersthan__or equal to 2. Image is aboveWhat is the area?15 cm20 cmsquare centimeters which is the next leap year after to 2017 Ashleigh can choose from one of 6 different routes to get to work. The routes are listed below. Main St. Route 6 Hilltop Drive Medical Avenue Highway 220 Friendship BoulevardIf she chooses one route at random, what is the probability that she will choose either Hilltop Drive or Medical Avenue to get to work? How would adding finer particles to the sand affect porosity? Business A must have ________ in cogs if it can produce them for a lower opportunity cost than any other producer of cogs.an absolute advantagea comparative advantagea decreasing trade-off valuerelatively low-quality factors of productionrelatively poor manufacturing technology Fix the one word that is used incorrectly. The secretary of state, whose appointed by the president of the United States, is the country's chief adviser on foreign affairs. HelppppppppppppppppppppppppppppppppppEasyyy 3. Which organism has DNA located in three organelles?A. A spongeB. A fern plant C. A flatwormD. A bacterium Superior Developers sells lots for residential development. When lots are sold, Superior recognizes income for financial reporting purposes in the year of the sale. For some lots, Superior recognizes income for tax purposes when the cash is collected. In 2020, Superior sold lots for $40 million for which no cash was collected at the time of the sale. This cash will be collected equally over 2021 and 2022. The enacted tax rate was 40% at the time of the sale. In 2021, a new tax law was enacted, revising the tax rate from 40% to 25% beginning in 2022. Calculate the total amount by which Superior should change its deferred tax liability in 2021. (Enter your answer in millions rounded to 2 decimal places (i.e., 5,500,000 should be entered as 5.50).) HELP MEEEEEEEEEE I NEED HELPPPPPPPPPPPPPPPPPPP 1%The positions of towns A, B and C are shown in the scale diagram below..B.AScale: 1 cm represents 10 milesIsmael's house is the same distancefrom town A and town B.His house is exactly 20 miles from town C.Use the x tool to show all the possible positions of Ismael's house.You must show all your construction lines.[5] Sarah competes in a long jump competition.Her first jump is 4.25 m.I Her best jump is 12% more than this.However, her best jump is 15% lower than the winning jump.Work out the length of the winning jump. a particular genetic disorder is associated with a single gene with two alleles individuals with two recessive allelles are affected. the prevalence if the disroder is 1 in 6,600 (mc)how did the election of ulysses s. grant in 1868 change reconstruction? Imagine this chapter had a playlist to set the mood, choose 5 songs that would be on that list- from chapter 5 lord of the flies.