y varies directly as x . when x=3 , then y=12 . find y when x=20.

Answers

Answer 1

Answer:

Congress. would equal 80 due to x being worth 1/4 of y's total.


Related Questions

5 What rate of interest is paid on a deposit of $2000 which earns $400
interest in 5 years?

Answers

Answer:

4%

Step-by-step explanation:

Given

I = 400P = 2000R = ?T = 5 years

Formula

I = PRT

Solving.

I = PRT400 = 2,000 × R × 5400 = 10,000 × R400 / 10,000 = R0.04 = R

Change 0.04 to percent

0.04 × 100 = 4%

Answer:

4%

HELP THIS IS URGENT!!!!!!!!!!!!!1Fill in the blank so that the equation has the solution x=3
3x+ =5

Answers

That makes noooo sense booooyyyy

Answer:

y = 3x + 5

Step-by-step explanation:

Since this is a linear function, its graph is a straight line stretching from - infinity to infinity on both x and y axes, hence domain and range is all real numbers from - infinity to infinity.

GRAPHING LINEAR EQUATIONS PLEASE HELP

y=2/5x -3

how do i graph this? i don't know where to start please help!

Answers

Step-by-step explanation:

you can let

x = 0 => y = -3, point ( 0,-3)y = 0 => x = -15/2 = -7.5, point (-7.5,0)

then connect this 2 points

please help.
with the steps.
just b, please ​

Answers

Answer:

  x² +3x -50 = 0

Step-by-step explanation:

The area expression you got in part (a) is ...

  A = (x +8)(x -5) = x² +3x -40

If the area is to be 10, then x must satisfy the equation ...

  10 = x² +3x -40

  x² +3x -50 = 0 . . . . . . subtract 10 and put in standard form

The volleyball team is having a carwash fundraiser. The cost of each car wash is $5. They sold some season ticket packages, which brought in $1640. The goal of the team is to make at least $2000 from the combined totals of the two fund-raisers. How many cars must they wash in order to meet the team goal of $2000?

Answers

Answer:

They need to wash 72 cars

Step-by-step explanation:

2000 - 1640 = 360

360/5 = 72

For question 1, find the x- and y-intercept of the line.
-10x -5y=40
A. x-intercept is 5; y-intercept is -10
B. x-intercept is 8; y-intercept is -4
C. x-intercept is -10; y-intercept is 5
D. x-intercept is -4; y-intercept is 8

Answers

The correct answer is D. x is (-4,0) and y is (0,-8)










Li designed a survey to determine how comfortable students at her middle school are with fractions. There are 600 students in her middle school. The students are equally distributed among grade levels. She selected a sample of 28 students in her first-period class. Which best explains Li’s sample? random and biased random and unbiased nonrandom and biased nonrandom and unbiased.

Answers

Answer:

unbiased nonrandom

Step-by-step explanation:

By picking only people from 1st period they are not random.

They haven't said anything that would make these people biased.

Answer:

unbiased nonrandom

Step-by-step explanation:

Plzzz help me it’s due tonight!!!!!

Answers

Answer:

UV=5, VW=5[tex]\sqrt{3}[/tex], and m∠U=60

Step-by-step explanation:

sin 30=UV/10=>0.5=UV/10=>UV=5

VW=√(10²-5²)=√75=5√3

m∠U=180-90-30=60

how do you write 8.16 × 101 in standard form?

Answers

Help me and mark as brainliest plz


Triangle NLM is reflected over the line segment as
shown, forming triangle ABC. Which congruency
statement is correct?
NLM - CAB
NLM -CBA
NLM - BCA
NLM - BAC

Answers

NLM-CAB would be the right answer

Triangle NLM is reflected over the line segment as shown, forming triangle ABC  then the correct congruency statement is NLM ≅ CAB

What is Triangle?

A triangle is a three-sided polygon that consists of three edges and three vertices.

Triangle NLM is reflected over the line segment and form the  triangle ABC.

Triangle NLM is reflected over the line segment to form triangle ABC. This means that the corresponding sides and angles of the two triangles are congruent.

The reflection over a line segment preserves the orientation of the triangle, so the order of the letters in the names of the triangles should remain the same.

Therefore, triangle NLM is reflected over the line segment as shown, forming triangle ABC  then the correct congruency statement is NLM ≅ CAB

To learn more on Triangles click:

https://brainly.com/question/2773823

#SPJ7

HEEEELLLLLPPP QUICKKK
28° + x-4°+2x=180°

Answers

Answer:

x = 52

Step-by-step explanation:

28 + x - 4 + 2x = 180

Simplify the left side

3x + 24 = 180

Subtract 24 from each side

3x = 156

Divide each side by 3

x = 52


PLEASE HELP! No phony answers, thanks! Happy holidays, Merry Christmas!!

Answers

Step-by-step explanation:

(f+g)(x) means we just add the 2 functions, so we have

(x-3) + 2x² = 2x² + x - 3

(f-g)(x) means we subtract g(x) from f(x), so we have

(x-3) - (2x²) = -2x²+x-3

Assuming that the dot signifies a multiplication sign and not a composition  sign, we have

(f*g)(x) = f(x) * g(x)

= (x-3) * 2x²

= 2x³ - 6x²

Plugging -2 in, we get

2(-2)³-6(-2)² = -16 -24 = -40


What is NOT the value for p? (Multiple Answers)
9
8
6
7

Answers

The definite value for p is 9.

But how are 8, 7, or 6 the value of p?

I personally think that you should contact the teacher who made this question. He/She probably meant to say What IS the value for p?

You use algebra to get the value for p:

20p-45 = 9p + 5p

Start solving from there.

A student earned a grade of 82% on a math test that had 20 problems. How many problems on this test did the student answer correctly? (round to the nearest whole number)

Answers

Answer:  16

Work Shown:

82% of 20 = 0.82*20 = 16.4 which rounds to 16

PLS HELP! 31 POINTS!!)) John plans to practice piano at least 2 1/2 hours this weekend. If he practices 1 1/6 hours on Saturday and 1 1/4 hours on Sunday, will he meet his goal? A. Yes; he will practice a total of 2 5/12 hours, and 2 5/12 > 2 1/2 . B. No; he will practice a total of 2 5/12 hours, and 2 5/12 < 2 1/2 . C. Yes; he will practice a total of 2 7/12 hours, and 2 7/12 > 2 1/2 . D. No; he will practice a total of 2 7/12 hours, and 2 7/12 < 2 1/2 .

Answers

Answer:

2 hours 30 minutes = goal

Saturday = 1 hour 10 minutes

Sunday = 1 hour 15minutes

Total = 2 hours 25 minutes

No he will not meet his goal. He will be short 5 minutes of practice.

Explanatiory:

if I’m wrong, I’m sorry. If I’m right, mark me brainlest!

Answer:

ill see im on the yest rn

Step-by-step explanation:

Please answer circle theorem question.
Many thx.

Answers

Answer:

x = 125

Step-by-step explanation:

Tangents from an external point to a circle are congruent , that is

CA = CB

Then Δ ABC is isosceles with base angles being congruent

∠ BAC = ∠ ABC = [tex]\frac{180-70}{2}[/tex] = [tex]\frac{110}{2}[/tex] = 55°

∠ ABC and x are adjacent angles on a straight line and sum to 180° , so

x = 180° - 55° = 125°

Then x = 125

Simplify.

(–28xy) ÷ (–4)


−7xy

17ab

−17ab

7xy

Answers

If any doubt leave a comment

What is the length of AB?

Answers

Answer:

6

Step-by-step explanation:

PLEASE HELP ASAP
Simple interest:
The length of time for £5000 to earn £1000 if invested at 10 percent per annum

Answers

Answer:

2 years

Step-by-step explanation:

1) principle:$5000

Rate : 10%

S.I = $1000

Therefore length of time =

S.I x 100 divided by Principle x rate

= 1000 x 100 divided by 5000 x 10

Answer= 2 years.

If correct please give brainliest

Stay safe and healthy

Thank You

Please Help Question in picture

Answers

Answer:

i want  to help... but there is no picture :/

Step-by-step explanation:

picture is gone D:

.

1 1/3 x 5 Multiply and answer with a mixed number in the simplest form.

Answers

Answer: 6 2/3

4/3 * 5

20/3

6 2/3

A milkman bought 40 litres of milk at rs. 26.50 per litre and added 6 litres of water to it. He sold the mixture at rs. 17 per litre. How much did he gain? ​

Answers

cp of 40 l of milk=6.50*40=260

sp of 56 l of mixture=56*7=392

392-260=132

gain%=132/260*100=50.76%

Please help me with my math homework what is the answer!!!

Answers

Answer:

Step-by-step explanation:

The letters are easy enough.

y^3 determines that 3 ys are needed. y^2 is taken in by the cubed.

x^4 determines that 4 xs are needed. x^3 is part of x^4 and you don't need any more xs

12 and 42 are the parts that will cause the problem. Factor them both into prime factors

12: 2 * 2 * 3

42: 2 * 3 * 7

You need two 2s.

You need one 3

You need one 7

LCD = 2 *2*3 * 7 = 84

X- 7y = -21 2x -14y =-42

Solve by substitution.

Answers

This is the possible solution. If the question isn't set up right Please tell me and I'll fix what needs to be changed. All the best

the given system of equations has no Solution.

What are Systems of equations?

Simultaneous equations, a system of equations Two or more equations in algebra must be solved jointly (i.e., the solution must satisfy all the equations in the system). The number of equations must match the number of unknowns for a system to have a singular solution.

There are four methods for solving systems of equations: graphing, substitution, elimination, and matrices.

Given, a system of equations:

X- 7y = -21......(1)

2x -14y =-42.....(2)

From equation 1

x = -21 + 7y

Substitute the value in equation 2

2(-21 + 7y) -14y-14y = -42

Since the given equation are same

Therefore, given equations have no Solution.

Learn more about the System of equations here:

https://brainly.com/question/12628931

#SPJ2

express the following fractions as the sum or difference of two fractions (x^2+y^2)/x^4

Answers

Answer:

 [tex]\frac{1}{x^2}[/tex] + [tex]\frac{y^2}{x^4}[/tex]

Step-by-step explanation:

[tex]\frac{x^2 + y^2}{x^4}[/tex] = [tex]\frac{x^2}{x^4}[/tex] + [tex]\frac{y^2}{x^4}[/tex] = [tex]\frac{1}{x^2}[/tex] + [tex]\frac{y^2}{x^4}[/tex]

The solution of the expression (x²+y²)/x⁴ is [(1/x² + y²/x⁴)].

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

The given expression is  (x²+y²)/x⁴. The expression will be solved as,

E =  (x²+y²)/x⁴

Separate the terms into two fractions,

E =  (x²+y²)/x⁴

E = (x²/x⁴) + ( y² / x⁴)

Divide the divisible terms and solve,

E = (1/x² + y²/x⁴)

To know more about an expression follow

https://brainly.com/question/17581179

#SPJ2

Look at the picture please help

Answers

Answer:

c

Step-by-step explanation:

First off, we know that (g ° f)(2) is just both functions done in a ordered fashion. In this case, f(x) is done first.

To figure out what f(2) is, all we have to do is find where x = 2 is on the graph. In this case it is on point (2, 3). The input is the x and the output is the y, so f(2) = 3.

Then, we can figure out what g(3) by locating x = 3 on line g. It shows the point (3, 0). This means that g(3) = 0.

Find the explicit formula for the n​th term of the following sequence where the first term is a1
{-6/7, 7/9, -8/11, 9/13, -10/15, ...}

Pls no links, I actually need help

Answers

The numerators in each term are consecutive integers ≥ 6. If n = 1 refers to the first term, then the numerator of the n-th term would be n + 5.

The denominators are consecutive odd integers ≥ 7. Odd numbers take the form 2k - 1, where k is any integer, and 2k - 1 = 7 when k = 4. But we want our sequence to start at n = 1, so we replace k here with n + 3. Then the denominator of the n-th term would be 2 (n + 3) - 1, or 2n + 5.

The odd-indexed terms are negative, while the even-indexed terms are positive. We can account for the sign of the term by multiplying by (-1)ⁿ.

Taking everything together, it follows that the n-th term in the sequence is

[tex]a_n = (-1)^n \dfrac{n + 5}{2n+5}[/tex]

Aisha is playing a game in which she can gain or lose points on each turn. The table below shows the points she scores on each of four turns in the game. Aisha states that her highest score is on turn 3, because 16 is greater than 3, 10, or 9. Use the drop down menus to explain Aisha’s mistake. Please help.

Answers

Answer:

Step-by-step explanation:

Complete the statement. Round the nearest hundredth if necessary.
6.5L=. Gal

Answers

Answer:1.72Gal

Step-by-step explanation:1 Gal is 3.785 L. 6.5 / 3.785 = 1.72

Interest earned: $76
Principal: $800
Interest rate:?
Time: 2 years

Answers

Answer:

19%

interest earned = base × time × rate

interest rate = interest earned/ base × time

76/800*2 = 0.19 = 19%

Other Questions
EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg)