Anyone do art? Like drawing, Painting etc.
Try to put a picture of your art!


(Im supposed put a bunch of pictures of peoples art for a homework/art project!

(I'll post this question a few times more than 2 can show their art!)

Answers

Answer 1
Yes I do! Here is one of my drawing of Wacko from the animanics!
Anyone Do Art? Like Drawing, Painting Etc.Try To Put A Picture Of Your Art!(Im Supposed Put A Bunch Of
Answer 2
Here this is my art I have more if you want and you should follow my pics art
Anyone Do Art? Like Drawing, Painting Etc.Try To Put A Picture Of Your Art!(Im Supposed Put A Bunch Of

Related Questions

10 pts please help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

I think its B the darkest area!?!?!

Answer:

I think it is "the darkest area"

Explanation:

When dealing with composition and layout, white space does the following: (select all that apply)

Question 8 options:


Defines and separates different sections



Gives content room to breath



Neutralizes the color in your layout

Answers

Answer:

A + B pretty sure !!!

Explanation:

white defines and separates sections while also giving content room to breathe, but it doesnt neutralize colors

hope this helps !!

Answer:

defines and separtars

Explanation:

yey, hope this helps. have a good day

My art teacher said she wanted us to compose a piece of art in music form. She wants it to rhyme. She says she will give 5 extra points if I can come up with a rhyme that ends in tackson in one of the rhymes. Help me. Preferably have the 5 point thing in your answer. Please help.

Answers

Answer:

h ttp s:// www .you tube .com /w at c h?v =d Q w4 w 9 W gX c Q

Maybe for the extra credit say meet Tackson thanks to Janet Jackson or something

What is the difference between a rehearsal, developing rehearsal and dress rehearsal? Please explain in 3 complete sentences.

Answers

What is the difference between elaborative rehearsal and maintenance rehearsal in terms of (a) the procedures associated with each type of rehearsal and (b) their effectiveness for creating long-term memories

Elaborative rehearsal is connecting what you're trying to know to something you already know; is much effective for creating long-term memories ; involves thinking the meaning, and making a connection to prior knowledge

Maintenance rehearsal simply means holding something in your memory by repeating it over and over rather than connecting it to something meaningful; involves large repetition without connection to prior knowledge;not very effective for creating long-term memories and involves shallow processing with little attention to meaning

what the person above me said

Anyone do art? Like drawing, Painting etc.
Try to put a picture of your art!


(Im supposed put a bunch of pictures of people's art for a homework/art project!

(I'll post this question a few times so more than 2 can show their art!)

Answers

Is this acceptable? I have this I’ve painted and I’m proud of it I put it on my wall. Hope you get a good grade :)
Here is my baby yoda art

Anyone do art? Like drawing, Painting etc.

Try to put a picture of your art!


(Im supposed put a bunch of pictures of peoples art for a homework/art project!

(I'll post this question a few times more than 2 can show their art!)
and this image I put of my art is old. I kinda improved a little in my newer drawings.

Answers

Answer:that’s some nice art

Explanation:

Here’s mine it’s not perfect but whatever lol

Seurat studied traditional ways of painting and then combined modern ideas from the Impressionists and scientific ideas about color, light, and the human eye (optics). Can you think of an example of an artist, artwork, musician or piece of music that combines old and new ideas to make something new?

Answers

Hhhhhhhhhhhhhhhhhhhhhhhnhhjhhhhhhjjjjjjjnbhhhh

Answer:

do you still need help

Explanation:

Rp
Lily, 13, 11 in wolf years, tribrid (werewolf,vampire,witch), straight, on a full moon i tun into a wolf, my curse was triggered when I was seven because I ran into the street and caused a school bus to crash int a tree and the driver died, i am still learning spells, and only drink out of blood bags.

Answers

Answer:

Yay rp time. Abby, 10 in wolf years and is 12 in human years (Not real age) straight and can change from human to wolf and usually the color blue and white, can fly, can teleport, and use telekinesis.

Explanation:

The heck is this. Also ur art is cool keep it up

Can someone give me the hex code for this image?

Answers

Did you need for every single color? Or just that whole thing
Purple:#363586
Orange:#DE5A22
Light blue:#54A3D0
Teal:#569399
Green/blue:#176170
Light orange:#F98737
Red:#E04E2D
Yellow:#F4B233

What are the four different orchestral instrument families?
Name five string orchestral string instruments.
What are the most common brass instruments used in an orchestra?
Name four percussion instruments.
Name two different categories of orchestra.
Critical Thinking Questions
What is your favorite musical instrument? Why?
What is a musical repertoire and how are they created?
How are instrument families created?
Which of the orchestral instrument families make sound with vibrating strings? Please name one of the ways that sound can be made through vibrating strings.
How is pitch related to the size of the instrument?
I WILL MARK BRANLIEST!!!

Answers

The orchestral brass instruments are the trumpet, French horn, trombone, and tuba. As with the woodwinds, the number of each of these instruments varies depending on the size of the orchestra and the piece being played. There are usually two to five each of trumpets, horns, and trombones, and one or two tubas.:)

Answer:

What are the four different orchestral instrument families?

Answer:Woodwinds,Brass,Percussion,and Strings

Name five string orchestral string instruments.

Answer:Violins,Cellos,Double Basses,Harp,and Violas

What are the most common brass instruments used in an orchestra?

Answer:Trumpet,Trombone,French Horn,Tuba,and Bass Trombone

Name four percussion instruments.

Answer:Timpani, Snare Drum,Bass Drum,and Cymbals

Name two different categories of orchestra.

Answer:Symphony and Chamber

Critical Thinking Questions

What is your favorite musical instrument? Why?

Answer:Depends on what you think depending on your instrument.Example:I love the Piano because,when a key has been pressed their are these hammer like keys inside the piano as it strikes a string to create the desired sound.

Here are almost a few answers to your questions :)

Explanation:

Ok so....
What you see in the picture are logo ideas I had for WNET 13 (Top left), WLIW 21 (Top Right), WNYC 31 (Bottom left), and WNYE 25 (Bottom right).
WNET 13 - Cityscape, heart formatted like an apple & heart-flag represents NYC, Heart with $ represents Manhattan.
WLIW 21 - NYC Life (current logo for WNYE) is referenced, except "tv" is replaced with "LI" (for Long Island), 21 is a reference to 1969-76 logo (second pic).
WNYC 31 - Overall is a reference to WNYC (AM & FM) logo since 2008.
WNYE 25 - I tried to convey the NYC subway system, and the city scape returns from the WNET idea.

Answers

Answer:

thats really good!

Explanation:

Great work :) looks good

The best way to compare two texts is

You can never compare fiction and non-fiction
if they are about the same topic regardless or genre
only when they have the same author
when they belong to the same genre

Answers

Answer:

that is not true

Explanation:

you can not really compare fiction or non fiction anyways because one of the stories are true and the other is not. so the story that is not true will have different features that are fantacy

You never compare fiction and non-fiction

50 points for Hex Color!
(i put 100, so you will get 45 for answeing this question and 50 for brainliest)

I really really need the hex triplet for this image. Also known as a hex digit? for example
#6495ed

Looking for the digits, please dont respond with something weird, its already happened

Answers

Answer:

#fc0384

Explanation:

love pink

#fc0384

I saw the picture

pink

If four 16th notes get one beat, how many 32nd notes fit in one beat?

Answers

Answer:

8

Explanation:

16x2=32 so 4x2=8

Answer:it’s 2 cus 16 x 2 is 32 so it’s 2 beats.

Explanation:

Seurat said, “Great things are done by a series of small things brought together.” What do you think he meant? Can you think of another example in art where a series of small things made a great thing? How about your life? What series of small things led to something big in your life?

Answers

Answer:

it doesnt matter how small or big they still matter or dont judge a book by it's cover  

TEST ANSWER

PLEASE IGNORE

Anyone do art? Like drawing, Painting etc.
Try to put a picture of your art!


(Im supposed put a bunch of pictures of people's art for a homework/art project!

(I'll post this question a few times so more than 2 can show their art!)

Answers

oh i do art! let me attach mine!

Answer:

kkkkkkkkkkkkkkkk

Explanation:

Were can i buy a Dr. Dre Pill 2.0 speaker

Answers

Answer:best buy,walmart supercenter,and target

Explanation:hope this helps you and me you you get the answer me I get brainliest plss

You can probably also get it from Amazon too! :)

What are octopuses addicted to?

(Example of what I mean kind of: Cats being addicted to catnip, something that isnt too bad for cats to have that cats are addicted to)

Answers

They are addicted to other small sea creatures
They like sea small creatures

It is best to position a product directly next to the background to eliminate glare.
True
False
AND IF YOU'RE THE PERSON THAT KEEPS PUTTING IN SCAM LINKS YOU WILL IMMEDIATELY GET REPORTED >:c

Answers

pretty sure it’s false !!
The answer would be false because it’s to the elimination

Picture for last question

Answers

Answer:

There ornage,purple,dark blue,light blue, red, and light orange

What’s the question??

PLEASE HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! 10 PTS pleaseeeeee

Answers

Answer: pretty sure its gradient hope this helps :) (:

Explanation:

Answer:

Gradient i think

Explanation:

If you are writing a rhythm that takes up four beats, could you include 2 whole notes? Why or why not?

Pls help, thanks :)

Answers

No. A whole note is 4 beats long so you can only do 1 per 4/4 time measure.

No. A whole note is 4 beats long, so you can only do 1 per 4/4 time measure is the rhythm that takes up four beats.

What is beat in music?

The beat is the basic rhythm and the bar in the music which is automatically played at the time of the beat. In music, the beat is the basic rhythmic component of a measure or bar.

It shouldn't be mistaken for rhythm in general, and it's not always the same as the piece of music's underlying pulse, which might last for more than one beat.

The beat is the basic time unit in music. It's a method that musicians utilize to stay in time with one another and is commonly linked to the pulse that music listeners typically feel. In other words, when someone claps along or dances to the music, they are moving to the rhythm.

Thus, No. A whole note is 4 beats long, so you can only do 1 per 4/4 time measure.

For more details about beat in music, click here:

https://brainly.com/question/4909790

#SPJ2

Anyone do art? Like drawing, Painting etc.
Try to put a picture of your art!


(Im supposed put a bunch of pictures of people's art for a homework/art project!

(I'll post this question a few times so more than 2 can show their art!)





( OML! Who ever done this masterpiece is so good at art!)

Answers

Not the best but its the only one I have saved on my phone.
This is my most recent one that I made. It’s stippled Freddie Mercury

I need help with this

Answers

Answer:

check over it it will help find what you missed

ummmmmmm try sparknotes for the poem and see if it has anything to help or any websites or anything like that

Anyone do art? Like drawing, Painting etc.

Try to put a picture of your art!


(Im supposed put a bunch of pictures of peoples art for a homework/art project!

(I'll post this question a few times more than 2 can show their art!)

Answers

I loveeee art I’m not the best at it but it’s something I take interest in. Hope this helps!!
Random doodle I made

What do you think is the most difficult task of being a composer? Why?

Answers

I think that the hardest part of being a composer is because it is a tedious job and it takes lot of time you have to be a composer, musician, and more all in one which is difficult at times.
It’s hard because you need to lean hand movements that you have not leaned and you could give a qui to the group you shouldn’t have

Who is David Murray, the saxophonist. Please don't copy and paste from somewhere popular

Answers

David Murray, the saxophonist, is an American jazz musician who plays tenor saxophone and bass clarinet as his main instruments.
He is a jazz musician Who plays saxophone and clarinet

This is the last time I'm doing this.

Answers

Answer:

Hihi

Explanation:

Last time doing what? If its free points then sign me up lol

Eeee

Eeeeee

Eeeeeeeeee

EEEEEEEEEEEEEEEEEEEEEE

EEEgib me big brainEEФωФ

baka

What is a theme of the novel or short story that you read? Write a theme sentence to describe a lesson that readers can learn from the story.

(The story is A wrinkle in time)

Answers

Answer:

Never follow people you don't know into a portal

Explanation:

That you need to be kind to everyone. You never know what they are going through, be kind to them no matter what. Even if you hate them you should be kind to them.

Anyone do art? Like drawing, Painting etc.
Try to put a picture of your art!


(Im supposed put a bunch of pictures of people's art for a homework/art project!

(I'll post this question a few times so more than 2 can show their art!)


Enjoy this ugly fanart of Tubbo, Ranboo and Micheal.

Answers

Answer:

This is one i did for my advanced art class yesterday :)

Explanation:

Here’s some sally face fanart if you need realistic art I can give some just send a comment
Other Questions
Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid) 8. (5 pts) what is (0.00034) x 48579? make sure the reported answers is rounded properly. a) 16.5 b) 17 c) 16.517 d) 16.52 : In its 2019 annual report, Whirlpool Corporation reported that it had revenues of RM18.1 billion, cost of goods sold of RM15.2 billion, accounts receivable of RM2 billion, inventory of RM2.4 billion, and account payable of RM3.71 billion. (a) Calculate cash conversion cycle Whirlpool Corporation (assuming a 365-day year). (6 marks) (b) Draw a timeline for Whirlpool's operating cycle and cash conversion cycle. your home insurance provides for replacement value for personal property losses. a microwave is stolen. it cost $270 two years ago and has an expected life of six years. a comparable microwave costs $385 today. what amount will the insurance company pay? In t = 0, SpaceY Inc. is an unlevered company whose Beta is 2. The risk free-rate in the economy is 5%, and the market return is 10%. To begin with, assume that capital markets are perfect and Modigliani-Miller (MM) assumptions hold true. Determine the required cost of equity using CAPM.