Answers
Answer:
The Correct awnser is D
Explanation:
Earth has 75% of our space is made up of water and most of it comes from our ocean.
BRAINLIEST PLEASERelated Questions
which of the following is not true about the cell membrane
Answers
Phospholipid heads are negative and attracted to water is not true about the cell membrane.
What is the overall net gain of ATP in aerobic respiration per one molecule of glucose?
between 0-10
between 10-20
between 30-40
between 40-50
Answers
Overall net gain of ATP in aerobic respiration per one molecule of glucose is between 30-40.
What do you mean by aerobic respiration?Aerobic respiration is the process of cellular respiration that takes place in the presence of oxygen gas to produce energy from food.
During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts.
Aerobic respiration provides energy to fuel all cellular processes. The reactions produce ATP, which is then used to power other life-sustaining functions, including growth, repair, and maintenance.
Learn more about aerobic respiration:
https://brainly.com/question/12605249
#SPJ1
Down syndrome can be observed in a karyotype/karyogram Xray frameshift point mutation
Answers
Down syndrome can be observed in a O karyotype/karyogram O X ray O frameshift point. DNA replication is necessary for all the responses are correct O growth
Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?
Answers
Anwser: Methionine-Proline-Glutamate.
The chain of amino acids would be produced by the given sequence of mRNA is as follows:
Tyr-Tyr-Ala, Val-Asn-Cys. What do you mean by Amino acids?Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.
The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.
Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.
To learn more about Amino acids, refer to the link:
https://brainly.com/question/14351754
#SPJ2
which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. if a restriction enzyme is combined with a piece of dna that contains its restriction site, the result will be restriction fragments. if a restriction site is cut with a restriction fragment, the results will be multiple restriction enzymes. if a restriction fragment is cut with a restriction enzyme, even more restriction fragments will be produced. if a restriction enzyme is cut at its restriction site, the result is one or more restriction fragments.
Answers
The restriction enzymes when combined with the DNA containing restriction sites lead to cuts at those sites yielding restriction fragments. The second statement is correct.
The restriction enzymes are the enzymes that recognize specific sites known as restriction sites. These are enzymes that are found in bacteria and this feature is used as a modern biotechnology tool for genetic editing.
There are two ways the ends are formed after the action of a restriction enzyme. It can form blunt ends or sticky ends. The sticky ends have a region at the end that is single-stranded. This region can then join according to the complementary base pairing with another strand having complementary sticky ends.
If it is assumed that the RE (restriction) enzyme is not interrupted during the generation of restriction fragments, the resulting restriction fragments would not yield more restriction fragments when re-incubated with the RE enzyme.
A restriction enzyme cuts only at restriction sites forming restriction fragments that do not yield more restriction fragments on subsequent action of the restriction enzyme.
In conclusion, the action of restriction enzymes on DNA gives smaller fragments of DNA. The second option is correct.
Learn more about restriction enzymes here:
https://brainly.com/question/28197487
#SPJ12
Which of the following statements about dinoflagellates is false?
A) They possess two flagella.
B) Some cause red tides.
C) their walls are composed of cellulose plates.
D) Many types contain chlorophyll.
E) Their fossil remains form limestone deposits.
Answers
The false statement about dinoflagellates is their fossil remains form limestone deposits.
Thus, the correct answer is E.
What are dinoflagellates?Dinoflаgellаtes аre motile unicellulаr аlgаe chаrаcterized by а pаir of flаgellаe. Mаny dinoflаgellаtes аre photosynthetic, whereаs others аre mixotrophic. Whereаs most аre strictly mаrine, some dinoflаgellаtes occupy brаckish аnd freshwаter environments.
Dinoflаgellаtes аlso exhibit remаrkаble trаits: In аddition to chlorophyll, some possess cаrotenoid pigments (dinoxаnthin аnd peridinin), giving them а flаmboyаnt red colorаtion, whereаs others аre bioluminescent. Some species form blooms in the oceаns, а phenomenon cаlled “red tide” due to colorаtion of the wаter resulting from the intense concentrаtion of аlgаl cells. Dinoflаgellаtes аre encrusted with plаtes mаde of а cellulose-like mаteriаl аnd silicа.
For more information about dinoflagellates refer to the link:
https://brainly.com/question/28902387
#SPJ4
During Charles Darwin’s first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology. What evidence did he present? What did he describe as the “key” to the
formation of mountains?
Answers
He found fossils in top where it should be miles below.
Charles Darwin’s describe a lot of time as the key to the
formation of mountains.
Who is Charles Darwin?
Charles Darwin was an English naturalist, geologist, and biologist, widely known for his contributions to evolutionary biology.
Charles Darwin proposed that all species of life have descended from a common ancestor is now generally accepted and considered a fundamental concept in science.
Charles Darwin first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology found fossils in top where it should be miles below. So he concluded that a lot of time as the key to the formation of mountains.
Learn more about Charles Darwin at:
https://brainly.com/question/1279802
#SPJ1
If a strand of hair has a continuous medulla pattern, and the Medulla Index is 42, what species would it most likely be from?
Cat
Insect
Human
Polar Bear
Answers
Answer:
It's a cat
Explanation:
I got it correct on my exam.
When the medulla index is above 33 and has a continuous pattern it's animal hair.
The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biosphere
Answers
Answer:
The correct answer is D) Biosphere. The biosphere is the part of the earth that supports life. It includes all of the living organisms on earth, as well as the air, water, and soil that they depend on. The lithosphere, hydrosphere, and atmosphere are also important parts of the earth, but they do not directly support life in the same way that the biosphere does.
Explanation:
More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause
Answers
A sharp increase in capillary hydrostatic pressure would directly cause an increase in fluid movement to the interstitial spaces.
Capillary hypertension causes the production of a protein-poor ultrafiltrate, which when it enters the interstitial space increases the amount of the interstitial fluid.
A rise in small artery, arteriolar, or venous pressure raises capillary hydrostatic pressure, which favors filtration. Fluid filtration will be reduced if the hydrostatic pressure gradient (PC - Pi) reduces due to an increase in interstitial pressure. Large rises in tissue interstitial pressure, on the other hand, can cause tissue damage and cellular death.
Edema occurs when plasma oncotic pressure falls, hydrostatic pressure rises, capillary permeability rises, or a combination of these variables occurs. When lymphatic flow is impeded, edema can develop.
For more information on capillary hydrostatic pressure, visit :
https://brainly.com/question/28274088
#SPJ4
we have learned that reliance on culture has increased in the course of human history. yet the fact and mechanisms of evolution remain a key part of our human present and future because
Answers
The reason behind fact and mechanisms of evolution remain a key part of our human present and future is because c) people have not stopped adapting biologically. So, correct option is c
When an animal varieties is adequately dependent on gaining from others for at any rate a few parts of its conduct collection, social developmental cycles can emerge, and these cycles can modify the climate looked by regular determination following up on qualities.
To foster models of social development, we start by taking the hypothetically grounded and exactly tried speculations about our gaining brain science — who individuals gain from and what they will generally deduce while learning — to build models that look at what happens when bunches of people are learning in these ways, and communicating over ages.
On account of their devotion and recurrence of purpose, human social abilities to learn are most likely one of a kind in leading to combined social development, the cycle through which learning collects fruitful changes and fortunate blunders over ages
Hence, correct option is c
To know more about culture, visit here:
https://brainly.com/question/12678729
#SPJ4
(Complete question) is:
We have learned that reliance on culture has increased in the course of human history. Yet the fact and mechanisms of evolution remain a key part of our human present and future because
A.
they provide the clues to building a better human race by promoting directed speciation.
B.
the pace of evolution has been continuously increasing, as human cultural solutions have not been able to keep up with environmental changes such as global warming.
C.
people haven't stopped adapting biologically.
D.
they continue to justify anthropology's biocultural perspective.
E.
they determine, at the genetic level, our phenotype.
I WILL LOVE YOU FOREVER IF YOU ANSWER THIS TONIGHT : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.
Answers
When the dihybrid cross is made between two TtRW plants, then the ratio of genotype produced from this cross will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).
What is inheritance?
Inheritance is the process through which genetic information is passed on from the parents to their offspring. This is possible through the gametes which fuse together to form zygote (2n). This zygote have similar characteristics to both of the parents.
In mendelian inheritance, complete dominance is observed which states that an allele could be completely dominant or completely recessive there is no in between.
However, some exceptions like incomplete dominance and codominance have been found later where, the presence of two contrasting alleles will lead to development of a phenotype which is in between the two.
In the F2 generation of the cross between the TtRW plants. The phenotype ratio will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).
Learn more about Dominance here:
https://brainly.com/question/14053639
#SPJ1
If you did an experimental cross and it got 1152 individual offspring how many of those offspring would have to be yellow to have a 3 to 1 yellow to green ratio from the cross
Answers
Answer: 864 yellow 288 green
Explanation:
where would you except to find the most of the sedimentary rocks on earth
Answers
4. As food travels through the digestive system, it is exposed to a variety of pH
levels. The stomach has a pH of 2 due to the presence of hydrochloride acid (HCI),
and the small intestine has a pH ranging from 7 to 9. HCI converts pepsinogen into
pepsin, an enzyme that digests proteins in the stomach. Which of the following most
likely happens to pepsin as
it enters the small intestine?
A. It becomes inactive.
B. It begins to replicate.
C. It's shape changes to engulf large proteins.
D. It's activity increases
to digest more proteins.
Answers
In the process of , DNA is used as a template for making another type of nucleic acid called . The process begins when the enzyme binds to a region called the .
Answers
In the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.
What is transcription?Transcription is a genomic process in which RNA is generated from DNA. This will generate an mRNA that will contain the genetic information of the protein that the gene encodes.
Transcription will be generated in the nucleus of the cell, there the RNA polymerase will bind to the DNA in the promoter to begin to generate the RNA copy, generating a transcription bubble to generate the RNA.
The transcription is preceded by the traduction that will take place in the cytoplasm of the cell to generate proteins from the mRNA.
Therefore, we can confirm that in the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.
To learn more about transcription visit: https://brainly.com/question/14136689
#SPJ1
Describe the four layers of the Earth and the response of at least three sentences name at least one important quality of each layer
Answers
Answer: the four layers of earth are: the inner core, the outer core, the mantel, and the crust. The inner core contains the heaviest elements and solid metals. The outer core is liquid and not as hot than the inner core. The mantel is the densest its solid but moves and that causes the earth quakes on the surface. The crust is the thinnest which is different under the ocean and on the continents. Its the coolest of all four and it consists of plates that are moving.
Explanation:
This plant group does not require water for sexual reproduction. this plant group does not require water for sexual reproduction. nonvascular plants seedless vascular plants seed vascular plants all of the above none of the above
Answers
because it is having asexual reproduction
1. Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule _________. Aerobic respiration requires the presence of Oxygen___________ and releases water and _________________ as waste products.
Answers
Answer:
Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule ATP. Aerobic respiration requires the presence of Oxygen and releases water and carbon dioxide as waste products.
Explanation:
NEED HELP DUE TOMORROW
Answers
Dependent variable is the amount of dirt and independent variable is the type of detergent used.
What are variables?Variables are defined as any characteristics, number or quantity which can be measured . It can also be called as a data item . It is called as variable because they can vary and can have variety of values.
There are three types of variables 1) manipulated variable where in a condition is specified, 2) responding variable which is dependent on manipulated variable 3)controlled variable which do not change
Example of manipulated variables are number of hours spent by a student studying , that of responding variable is result of a student and temperature is an example of controlled variable.
Learn more about variables,here:
https://brainly.com/question/15740935
#SPJ1
The _____ control(s) the force of a movement, whereas the_____ control(s) the timing and accuracy of the movement.a.motor cortex; basal gangliab.basal ganglia; motor cortexc.basal ganglia; cerebellumd.cerebellum; basal ganglia
Answers
The basal ganglia A movement's force is controlled by the cerebellum, while its timing and accuracy are controlled by the cerebellum.
What determines a movement's force?The Motor Complex The brain is in charge of all voluntary actions of the body. The motor cortex is one of the parts of the brain that is most crucial in regulating these voluntary movements.
What function does the basal ganglia play in motor control?The network of brain cells and nerves that manages your body's voluntary motions includes the basal ganglia as a significant component. Your brain sends movement signals that they can either approve or reject, screening away erroneous or superfluous impulses.
To know more about basal ganglia visit :-
https://brainly.com/question/4109433
#SPJ4
Name the main layers of a tropical rain forest. What kinds of plants grow in each
layer?
Answers
Answer:
Most rainforests are structured in four layers: emergent, canopy, understory, and forest floor.
review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.
Answers
Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.
The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.
A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.
To learn more about genotypes and phenotypes here
https://brainly.com/question/20730322
#SPJ4
What is the name of the signaling molecules used in endocrine signaling?
Answers
Answer:
The signaling molecules used in endocrine signaling are called hormones. Hormones are chemical messengers that are produced by glands in the endocrine system and released into the bloodstream, where they can circulate throughout the body and regulate the function of various organs and tissues. Some examples of hormones include insulin, thyroid hormone, and estrogen.
Explanation:
Body Systems
Which body system
transports oxygen and
nutrients to the body and
aids in the removal of
carbon dioxide and other
waste products?
Answers
Answer:
it would be The circulatory system
Explanation:
because it said transports oxygen and it the circulatory carry blood away towards the heart.
The cortical regions indicated by E are involved in which functions?
A. The production and interpretation of language.
B. The storage of motor patterns for skilled movements of skeletal muscles.
C. The generation of emotional responses.
D. The control centers for homeostatic and endocrine functions.
Answers
The cortical areas indicated by E are involved in the functions of the production and interpretation of language.
The true choice is A.
The most important part of the brain in language activities is the cerebrum. The part of the cerebrum that is directly involved in language processing is the cerebral cortex. The cerebral cortex is the part that looks like white lumps and is the largest part of the human brain system. This section regulates or manages cognitive processes in humans, and one of them, of course, is language.
The cerebral cortex consists of two parts, namely the left hemisphere and the right hemisphere. The right hemisphere controls the processing of spatial and visual information (seeing, coloring, or perceiving spaces or objects in three dimensions). While the left hemisphere controls language activities besides, of course, other cognitive processes. Coordination between the two is possible because of the structure that identifies these two parties, namely the corpus callosum.
This question is accompanied by an image.
Learn more about the brain works in the process of language at https://brainly.com/question/12423054
#SPJ4
sort the following protein complexes of the electron transport chain according to whether they are involved in pumping protons across the inner mitochondrial membrane or not.
Answers
A protein complex is a sub-atomic machine that comprises a few proteins (nucleic acids and different particles) that tight spot each other at a similar spot and time (e.g., record factors, histones, polymerases, and so forth.).
An electron transport chain is an assortment of protein edifices and different particles that utilize redox responses to energize an electron from electron givers to electron acceptors while likewise moving protons across a layer. Electrons are moved to start with one particle and then onto the next in the electron transport chain, and the energy delivered during these electron transporters is utilized to frame an electrochemical slope. The put-away energy in the angle is utilized to deliver ATP in chemiosmosis.
For more information on Electron Transport Chain, visit :
https://brainly.com/question/24372542
#SPJ4
eweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeewewee
Answers
Answer:ewe
Explanation:
ewe.
The region identified by location 4 on the map is classified as belonging to the tundra biome. Which of the following climate graphs most accurately depicts the conditions found in this biome?
A
B
C
D
Answers
Answer:
B
Explanation:
For more proof look at the second image
What was one strength of Darwin's theory?
a. He knew about genetics.
b. He knew that species change quickly in spurts.
c. A large amount of data supported his work.
d. He knew that some organisms reproduce at a greater rate than others.
Answers
Answer: C. A large amount of data supported his work.
Darwin did not know that genetics existed, but he did collect evidence from birds with a common ancestor and theorized that they split because of evolution.
Have a good day!
The one strength of Darwin's theory is the large amount of data which is supported by his work. Thus, the correct option is C.
What is Darwin's theory?Darwin proposed a theory which describes that a species can change over time, that a new species come from the pre-existing species, and that all the species share a common ancestor. In this model of Darwin, each species has its own unique set of heritable or genetic differences from the common ancestor, which have been accumulated gradually over a period of very long period of time.
Darwin used multiple lines of evidence to support his theory of evolution of population through natural selection such as fossil evidence, biogeographical evidence, and anatomical evidence. The one strength of Darwin's theory is the large amount of data which is supported by his work.
Therefore, the correct option is C.
Learn more about Darwin's theory here:
https://brainly.com/question/25718754
#SPJ2