which of the following is not found in an area of alpine glaciation?
A. V-shaped valleys
B. aretes
C. cirques
D. U-shaped valleys

Answers

Answer 1

V-shaped valleys are not found in an area of alpine glaciation.

The correct answer is "A".

Alpine glaciation refers to the process of glacial erosion and deposition in mountainous regions. It is characterized by the formation and movement of glaciers, which shape the landscape through the process of erosion. The options provided are all landforms commonly associated with alpine glaciation, except for V-shaped valleys. V-shaped valleys are typically formed by the action of rivers and are characterized by steep sides and a narrow bottom.

In contrast, alpine glaciation tends to create U-shaped valleys, which have a broad, U-shaped cross-section resulting from the glacial erosion and the smoothing of the valley floor. Aretes, which are narrow ridges between two glacial valleys, and cirques, which are bowl-shaped hollows at the head of a glacier, are landforms commonly found in areas of alpine glaciation.

The correct answer is "A".

To know more about alpine glaciation, click here.

https://brainly.com/question/32326334

#SPJ4


Related Questions

Which of the following best describes the dominant climate found in Southwest Asia?

Answers

Answer:

B.Arid

Explanation:

When the upper-level trough is located directly above a surface low pressure system, the midlatitude cyclone is most likely:
A. At the incipient stage.
B. Growing.
C. Decaying.
D. Experiencing a hurricane transition.
E. Turning into a thunderstorm.

Answers

B. Growing. When the upper-level trough is located directly above a surface low-pressure system in a midlatitude cyclone, it creates favorable conditions for the cyclone to strengthen and grow.

The upper-level trough enhances vertical motion in the atmosphere, leading to the intensification of the surface low-pressure system. This vertical motion allows for the upward movement of warm, moist air, which can lead to the development of clouds, precipitation, and the strengthening of the cyclone.

The interaction between the upper-level trough and the surface low-pressure system provides the cyclone with the necessary dynamics for intensification. As the cyclone grows, it draws in more air from its surroundings, further enhancing the vertical motion and intensifying the storm system. This stage is characterized by increasing wind speeds, intensifying precipitation, and a deepening of the low-pressure system.

Therefore, when the upper-level trough is directly above a surface low pressure system, the midlatitude cyclone is most likely in the growing stage.

To learn more about midlatitude cyclone, click here:

https://brainly.com/question/32141613

#SPJ11

HELP WHAT IS THE MISTAKE THE STUDENT MADE!?

Answers

Answer: I believe its A

Explanation:  Because Earth elvoves on its axis and rotates around the sun.

Two doors are each 36 inches wide. Door A is opened to a 11° angle. Door B is opened to

a 62° angle. Which door's outer edge is farther from its closed position? Justify your

answer.

Answers

Answer:

Door B.

Explanation:

The outer edge of the door B is farther from its closed position because of high angle. The door which have a greater angle has more outer edge from its closed position as compared to the door with lower angle. Here, the door A is open with an angle of 11 degree while on the other hand, the door B is pen with an angle of 62 degree so the door B has higher angle so we can say that door B has farther outer edge as compared to door A .

Which one of the following is an example of adiabatic heating? - A descending mass of air is warmed as it is compressed - University Lake is warmed by absorption of solar radiation - A home is warmed in the winter by a geothermal heat pump - Water is heated as it passes through the core of a nuclear power plant

Answers

An example of adiabatic heating is when a descending mass of air is warmed as it is compressed. (Option A)

How is this so?

As air sinks and encounters higher atmospheric pressure, it is compressed, causing its temperature to increase. This is due to the work done on the air, converting kinetic energy into thermal energy.

Adiabatic heating occurs without the exchange of heat with the surroundings.

The other examples mentioned, such as solar radiation warming University Lake, a geothermal heat pump warming a home, and water heated in a nuclear power plant, involve heat transfer processes and are not adiabatic.

Learn more about adiabatic heating at:

https://brainly.com/question/32134015

#SPJ1

Residents in ethnic enclaves are MOST LIKELY to

settle in urban areas as a result of chain migrations
settle in suburban areas as a result of return migrations
settle in suburban neighborhoods in gated communities
settle in rural areas to practice agriculture
settle in urban areas with homeowners associations

Answers

Settle in suburban areas as a result of return migrations.

Answer:

settle in urban areas as a result of chain migrations

Explanation:

chain migrations means more people causing urbanization

What are the impact of drought on environment​

Answers

Examples of environmental impacts include: Losses or destruction of fish and wildlife habitat. Lack of food and drinking water for wild animals. Increase in disease in wild animals, because of reduced food and water supplies.

Answer:

Examples of environmental impacts include: Losses or destruction of fish and wildlife habitat. Lack of food and drinking water for wild animals. Increase in disease in wild animals, because of reduced food and water supplies.

Why is the land breeze experienced at night?
need an explanation related to the following diagram

Answers

Land breezes usually occur at night because during the day the sun will heat land surfaces, but only to a depth of a few inches. ... The movement of the wind is a result of differences in air pressure over the land and the ocean. Warm air is less dense and rises, therefore cool air is more dense and sinks. At night, the roles reverse. The air over the ocean is now warmer than the air over the land. ... This causes a small temperature gradient between the ocean surface and the nearby land at night and the wind will blow from the land to the ocean creating the land breeze.  

The predominance of Roman Catholicism in Latin America is demonstrated by -?
the cultural celebrations of the region
the ethnic diversity of the region
the variety of music and dance in the region
the widespread use of Spanish in the region

Answers

Cultural celebrations. Aka the calendar along with Christmas and Easter and Sunday being church day

The regional festivals serve as a visual representation of how Roman Catholicism predominates in Latin America. Thus option (A) is correct.

What is Catholicism?

The term "Catholicism" covers a wide range of concepts, including the religion's theologies and "doctrines" as well as its style of worship (called liturgies). The phrase also describes Catholic ethical principles (things that are right and wrong). It also refers to the practices Catholics engage in.

The predominant religion in almost all of Latin America is Roman Catholicism. This can be largely due to the lasting impacts of the Roman Catholic missions that went along with Spanish and Portuguese colonization of the area.

Therefore, Thus option (A) is correct.

Learn more about Catholicism here:

https://brainly.com/question/2775064

#SPJ2

Give 2 social and economic impact of the summer monsoon for the people living in India?​

Answers

India gets around 70 percent of its annual rainfall during the monsoon season

A strong monsoon results in increased output within agriculture, and reduced commodity and bi-product prices.

Also, it allows increased ground water and restored reservoirs, helping the irrigation systems.

.Which of the following nitrogen cycle processes is occurring in the water sample as illustrated by the graph?
A. nitrogen fixation
B. denitrification
C. nitrification
D. anammox reaction

Answers

The graph shows a steadily increasing nitrate concentration in a water sample over time. This process is an example of nitrification, which is the first step of the nitrogen cycle.

The correct option is C.

Nitrification is the oxidation of ammonium (NH4+) to nitrite (NO2-) and then nitrate (NO3-) by bacteria. Nitrification is an important process in the nitrogen cycle because it releases nitrogen into the environment, which is necessary for the growth of bacteria, algae, and other organisms. Nitrate is also a necessary nutrient for certain plants, so nitrification is important for agricultural purposes.

Denitrification, anammox reaction, and nitrogen fixation, are all other processes that occur in the nitrogen cycle, but the graph does not show any of these processes.

To know more about Nitrification , click here:

https://brainly.com/question/14967934

#SPJ4

Which channel is more likely to have a lower velocity?
A. Meandering channels B. Braided channels

Answers

Braided channels are more likely to have a lower velocity.

What are braided channels?

Braided channels are created by a river or stream that divides into smaller waterways that intersect and rejoin at various points.

Braided channels typically occur where sediment (sand, gravel, and silt) is abundant, and the stream is confined within a relatively flat or shallow landscape. These channels are most common in the lower courses of the river, where sediment is plentiful and the river has little energy.

The velocity of the water is lower in braided channels because the water is spread over a wide area due to the numerous small channels, hence they are more likely to have a lower velocity.

What are Meandering channels?

Meandering channels are smooth, sinuous river channels with a low gradient. Meandering rivers are the most common in lowlands, where they create broad, flat floodplains called meanders that form due to the river's tendency to erode the outer banks and deposit sediment on the inner banks of curves. These types of channels typically have a higher velocity than braided channels, as they have fewer bends, which allows the water to move more quickly.

To know more about curves, visit

https://brainly.com/question/32496411

#SPJ11

who coined the term cell?​

Answers

Answer:

Robert Hooke coined the term cell

Explanation:

Why camels can't live in the other places except the dessert?​

Answers

Answer:

Camels have adapted and found ways to help them survive in deserts. They have a thick coat of hair that protects them from the heat in the day, and keeps them warm at night. They have water in their humps incase they don't have access to any. Their whole body structure is based on living in the harsh conditions of the desert.

Explanation:

why is it possible to issue a tsunami warning but not a warning for an impending earthquake? describe a scenario in which a tsunami warning would be of little value

Answers

A tsunami is a series of ocean waves that have long wavelengths and are produced by a disturbance in the ocean. Tsunamis can be caused by earthquakes, volcanic eruptions, landslides, or even meteorite impacts on the ocean.

A tsunami warning system can detect the occurrence of a tsunami and warn the public to evacuate the area as quickly as possible.

On the other hand, earthquakes are sudden and unpredictable, making it impossible to warn the public about an impending earthquake. Scientists can't predict when or where an earthquake will strike, and they don't know how strong it will be.Tsunami warnings are typically given after an earthquake occurs.

The seismometers in the region where the earthquake occurred detect the movement of the earth and send out a warning that a tsunami could occur. When the warning is received, people are given time to evacuate the area, which can save countless lives. In a scenario where the earthquake occurred too close to the coast, and the waves are too high, the warning would be of little value.

In this situation, it would be nearly impossible for people to evacuate in time, and the waves would cause severe damage and loss of life. In this case, it would be better to evacuate the area as soon as possible and not wait for a warning.

To know more about earthquack, visit

https://brainly.com/question/30322293

#SPJ11

Explain the three categories of biodiversity.
1.genetic

2.species

3.ecosystem diversity

give examples please

Answers

1.genetic
2.species
3.ecosystem diversity

when would the slave tribes move?​

Answers

When there was no food or resources in the area no more

Stream Flow Directions PURPOSE The purpose of this exercise is to help you understand how to easily determine stream flow directions on topographic maps. To complete this exercise, use the Renovo West, PA 7.5 minute quadrangle map to answer the following questions about stream flow directions. 6. Briefly describe one way that you can determine the direction of stream flow. 7. Briefly describe a second way that you can determine the direction of stream flow. 8. Briefly describe a third way that you can determine the direction of stream flow. 9. In what general direction is Barney Run flowing located-1000 ft east of 41°17′30″N. 77'50'00"W)? Answer: In what general direction is Stink Hollow Creek flowing (SE % of map)? Answer: In what general direction is Brewery Run flowing (NE % of map)? Answer: In what general direction is Two Mile Run flowing (headwaters located near 260000 mE 4584000 mN)? Answer 13. Do all streams flow to the south? Provide evidence to support your answer. 74 Stope Gradient, Topographic Profiles & Vertical Exaggeration 5-1 C 3:51 Done Renovo West Inset_Top... 1 of 2 76 74 73 63 100 1:34.300 7 1300 M 44 Q NEL.

Answers

Determining the direction of stream flow on a topographic map can be done in several ways. These include analyzing contour lines, observing the pattern of tributaries, and using elevation differences between different points along the stream.

1. Analyzing contour lines: Contour lines on a topographic map provide information about the elevation of the land. Streams tend to flow from higher elevations to lower elevations. By examining the contour lines near a stream, you can determine the general direction of flow. The contour lines will be closer together upstream, indicating steeper terrain, and farther apart downstream, indicating a gradual descent.

2. Observing the pattern of tributaries: Streams often have tributaries that join them along their course. The pattern of these tributaries can indicate the direction of flow. Generally, tributaries join a larger stream at an acute angle. By observing the angle at which the tributaries enter the mainstream, you can determine the direction of flow.

3. Using elevation differences: Topographic maps provide elevation information through contour lines or spot elevations. By comparing the elevations of different points along a stream, you can determine the direction of flow. Streams flow from higher elevations to lower elevations. By noting the elevation changes between points upstream and downstream, you can identify the general direction of flow.

9. In what general direction is Barney Run flowing (located 1000 ft east of 41°17′30″N, 77°50'00" W)?

Answer: Without specific elevation information, it is not possible to determine the precise direction of flow. However, based on the given location, Barney Run would generally flow towards the east.

Answer 13. Do all streams flow to the south? Provide evidence to support your answer.

Not all streams flow to the south. Streams follow the topography of the land, which can vary in different directions. The evidence for this can be seen on topographic maps where streams flow in various directions, not exclusively towards the south. The direction of flow depends on factors such as elevation changes, geological features, and the overall landscape.

To know more about topographic maps click here:

https://brainly.com/question/1026002

#SPJ11

I will give BRAINLIEST

Answers

Answer: A Decomposer

What changes in slope-channel connectivity would you
expect as you pass from upstream to downstream
locations?

Answers

The changes in slope-channel connectivity from upstream to downstream locations can vary, but generally, an increase in channel size and a decrease in slope steepness can be expected.

As you move from upstream to downstream locations in a river system, several changes in slope-channel connectivity can occur. Initially, upstream areas tend to have steeper slopes and narrower channels, resulting in a higher gradient.

However, as the river flows downstream, the gradient typically decreases, leading to a decrease in slope steepness. This decrease in slope allows the river to expand its channel width, resulting in increased connectivity between the river and its floodplain.

Additionally, downstream locations often experience higher water volumes and sediment loads, leading to the formation of larger channels and increased channel capacity. Overall, the changes in slope-channel connectivity from upstream to downstream locations involve a transition from steeper slopes and narrower channels to gentler slopes and wider channels.

To learn more about slope-channel connectivity click here: brainly.com/question/32500803

#SPJ11

Write one good paragraph to explain
1) At least one way humans use the environment (could be from history or modern times)
2) How they have benefited from that use (consider social and economic benefits)
3) Was the impact of their use positive or negative? Why?

Answers

Answer:

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. They use up resources like trees to make many things from paper to money. By that they use up a lot of trees and led to deforestation in that area. They use up all the fossil fuels for work to gain more money. The use of these has left a negative impact on the environment by using up everything and not replenishing it.

Why is the land breeze experienced at night?
need an explanation related to the following diagram

Answers

Answer:

Land breezes usually occur at night because during the day the sun will heat land surfaces, but only to a depth of a few inches.

During the night, water will retain more of its heat than land surfaces because water has a high heat capacity.

Explanation:

To add on, the temperature of the land cools quickly without the insolation from the sun.

Why has the Aral Sea shrunk and become saltier?

The climate has become more tropical.
A water pipeline has drained the lake.
Water was diverted from rivers to feed cash crops.
Factories have used up water resources.

Answers

Answer: Once the fourth largest lake in the world, Central Asia's shrinking Aral Sea has reached a new low, thanks to decades-old water diversions for irrigation and a more recent drought. Satellite imagery released this week by NASA shows that the eastern basin of the freshwater body is now completely dry.

The climate has become more tropical

HOPE THIS HELPS

Answer:

the climate has become more topical.

Explanation:

A topographic map showing contour lines that are close together on both sides of a river would most likely represent-

a) a steep mountain
b) a valley
c) a gradual slope
d) a canyon

Answers

d. Canyon I’m sure of it

Which of the following statements regarding the Bohr model of the hydrogen atom is incorrect?
a) Bohr's model shows the electron circling the nucleus in fixed orbits.
b) In Bohr's model, electrons could exist between orbits.
c) In Bohr's model, when an electron absorbs energy, it can move to a higher-energy orbit.
d) In Bohr's model, when an electron emits energy, it can move to a lower-energy orbit.
e) In Bohr's model, n = 1 is the lowest energy orbit.

Answers

The correct option is B,  The incorrect statement regarding the Bohr model of the hydrogen atom is In Bohr's model, electrons could exist between orbits.

Bohr's model, proposed by physicist Niels Bohr in 1913, revolutionized our understanding of atomic structure. At its core, the model describes the structure of an atom as a small, positively charged nucleus surrounded by negatively charged electrons orbiting it in specific energy levels or shells. These energy levels are quantized, meaning electrons can only occupy certain fixed orbits with distinct energies.

Bohr incorporated concepts from both classical physics and newly emerging quantum mechanics to explain atomic behavior. He postulated that electrons can jump between energy levels by either absorbing or emitting discrete packets of energy, known as photons. This process forms the basis for the emission and absorption of light at specific wavelengths by atoms.

To know more about Bohr's model refer to-

brainly.com/question/3964366

#SPJ4

What is Geologic Event? (please it's urgent)​

Answers

Answer:

An identifiable event during which one or more geological processes act to modify geological entities.

Explanation:

How could decreasing production lead to increased production? Production is increased by increasing hours of workers Production can be stalled while new direction is found Production was increased by finding new trading partners It cannot make this change

Answers

Answer:

11 is it

Explanation:

and plz no

Answer:

It cannot make this change

Explanation:

What type of weather front would likely be responsible for the following weather forecast? "Increasing high cloudiness and cold this morning. Clouds increasing and lowering this afternoon with a chance of snow or rain tonight. Precipitation ending tomorrow morning. Turning much warmer. Winds light easterly today becoming southeasterly tonight and southwesterly tomorrow."

Answers

Answer:

warm front

Explanation:

The warm front is the name given to the front part of a mass of hot air that is moving in the atmosphere. This warm front presents a large number of clouds and can present a light rain and even a fog due to the predominance of dense and hot air. This effect caused by the hot front can cause situations similar to those presented in the weather forecast shown in the question above, where a cloudy and cold environment can be seen, with the increase of clouds and the possibility of rain and snow.

A considerable body of knowledge concerning Earth's interior has been amassed through all these methods EXCEPT _____.
A) Drilling wells
B) Digging mines
C) Studying seismic waves
D) Studying Earth's magnetism
E) Sampling rocks from Earth's core

Answers

The correct answer is E) Sampling rocks from Earth's core. A considerable body of knowledge concerning Earth's interior has been amassed through all these methods.

A considerable body of knowledge concerning Earth's interior has been obtained through various methods such as drilling wells, digging mines, studying seismic waves, and studying Earth's magnetism. These methods have provided valuable insights into the composition, structure, and properties of Earth's interior.

Drilling wells and digging mines allow scientists to access deeper layers of the Earth's crust, providing direct observations and samples of rocks and minerals. Studying seismic waves, generated by earthquakes or artificially created, helps in understanding the behavior of waves as they travel through different layers of the Earth, providing information about its structure and composition. Analyzing Earth's magnetism helps in studying the magnetic field and its interactions with the materials within the Earth.

However, sampling rocks from Earth's core is not feasible as the Earth's core is located at depths of around 2,900 kilometers (1,800 miles) beneath the Earth's surface. This is beyond the reach of current drilling technology, so direct sampling from the Earth's core has not been possible. Nonetheless, scientists have been able to infer information about the Earth's core through indirect methods such as studying seismic waves and analyzing Earth's magnetism.

Therefore, the correct answer is E) Sampling rocks from Earth's core.

To learn more about Sampling rocks, click here:

https://brainly.com/question/2189593

#SPJ11

Find the latitude and longitude to the nearest minute for the
following cities.
1. Gisbourne, New Zealand
2. Prague, Czech Republic
3. Baton Rouge, Louisiana
4. Nashua, New Hampshire
5. Cairns, Queens

Answers

The latitude and longitude to the nearest minute for the following cities are given below.

1. Gisborne, New Zealand: Latitude - 38° 39' S, Longitude - 178° 01' E

2. Prague, Czech Republic: Latitude - 50° 05' N, Longitude - 14° 25' E

3. Baton Rouge, Louisiana: Latitude - 30° 27' N, Longitude - 91° 08' W

4. Nashua, New Hampshire: Latitude - 42° 45' N, Longitude - 71° 28' W

5. Cairns, Queensland, Australia: Latitude - 16° 55' S, Longitude - 145° 46'E

The latitude and longitude coordinates provide the geographical location of a particular city or place on the Earth's surface. Latitude represents the north-south position, with the equator at 0° and the poles at 90° north (N) and south (S).

Longitude represents the east-west position, with the prime meridian at 0° and ranging from 180° W to 180° E. The given coordinates for each city indicate their approximate location in terms of degrees, minutes, and direction from the reference lines of latitude and longitude.

To learn more about latitude and longitude click here: brainly.com/question/24460166

#SPJ11

Other Questions
as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid)